Regulation of phosphoenolpyruvate carboxykinase gene transcription by thyroid hormone involves two distinct binding sites in the promoter

Abstract

Transcription of the gene for phosphoenolpyruvate carboxy-kinase (PEPCK) is stimulated by thyroid hormone (T3), glucagon (via cyclic AMP) and glucocorticoids. A region of the PEPCK promoter between -332 and -308 mediates the induction of transcription by T3. To characterize this region further, mutations were introduced into this region of the PEPCK promoter and the modified promoters ligated to the chloramphenicol acetyltransferase (CAT) reporter gene. Using these PEPCK-CAT vectors in transient transfections in HepG2 cells, it was found that T3 stimulates PEPCK transcription through two direct repeats of the AGGTCA motif located between nucleotides -330 and -319 [PEPCK-thyroid-hormone-responsive element (TRE)]. The beta form of the T3 receptor (TR beta) bound PEPCK-TRE as a homodimer but bound far more efficiently as a heterodimeric complex with the retinoid X receptor (RXR). An additional region called P3(I) (-250 to -234) is required for T3 responsiveness and binds members of the CCAAT-enhancer-binding protein (C/EBP) family. P3(I) contains an AGGTCA-like motif that can bind the TR beta-RXR heterodimer. Mutagenesis of this motif abolished TR beta-RXR binding without reducing T3 induction. Mutation of the C/EBP-binding site or insertion of a cyclic AMP-responsive-binding-protein site at P3(I) eliminated the T3 response. Our results indicate that T3 stimulation of PEPCK transcription is mediated by TR beta bound to PEPCK-TRE and requires C/EBP to be bound at the P3(I) site.

Role of CCAAT Enhancer-binding Protein β in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription

“…Construction of CAT and Luciferase Vectors-The ligation of the PEPCK promoter from Ϫ490 to ϩ73 to the CAT reporter gene (Ϫ490-PCAT) has been described (7). To introduce the Gal4 binding site into the P3(I) site of the PEPCK promoter (Ϫ490-P3G4), the Ϫ490-PCAT vector containing a BstIIE site in the P3(I) element (Ϫ490P3(I)-PCAT) (8) was digested with BstIIE and SauI and the double-stranded oligomer containing the sequence ggttacctcggagtactgtcctccgt was inserted into nucleotides Ϫ248 to Ϫ223.…”

“…1A). The first is the PEPCK-T 3 -responsive element (PTRE) contained within nucleotides Ϫ330 to Ϫ319, and the second is a binding site for the CCAAT enhancer-binding protein (C/EBP) called P3(I) between Ϫ250 and Ϫ234 (7,8). The PTRE has an unusual architecture consisting of two direct repeats separated by zero nucleotides (7).…”

Cloning and characterization of the promoter for the liver isoform of the rat carnitine palmitoyltransferase I (L-CPT I) gene

“…HepG2 cells were transfected by calcium phosphate precipitation as described previously [24]. For the CPT-Luc vectors, each transfection contained 3n0 µg of CPT-Luc and 1n0 µg of SV40 (simian virus 40)-β-galactosidase (SV40-βgal) reporter gene as a transfection control.…”

“…Within the first 1000 bp, we have found several consensus C\EBP protein binding sites ( Figure 5) [24]. The C\EBPα isoform is believed to be an important regulator of genes encoding proteins involved in metabolism and to contribute to the induction of hepatic genes at birth [23,44].…”

The Synergistic Effect of Dexamethasone and All-trans-retinoic Acid on Hepatic Phosphoenolpyruvate Carboxykinase Gene Expression Involves the Coactivator p300

“…The expression of hepatic PEPCK is primarily accomplished at the transcriptional level (3). Glucagon (acting through cAMP), glucocorticoids, all-trans-retinoic acid (RA), and thyroid hormone activate PEPCK gene expression, whereas insulin and glucose are inhibitory (3)(4)(5)(6).…”