Regulation of Gonadotropin-Releasing Hormone (GnRH) Gene Expression during GnRH Neuron Migration in the Mouse

Abstract

The mechanisms underlying the migration of the gonadotropin-releasing hormone (GnRH) neurons from the nose into the forebrain are not resolved. In an attempt to characterize further the migrating GnRH neurons, we have employed in situ hybridization techniques and transgenic mouse models to examine levels of GnRH mRNA and GnRH gene transcription in GnRH neurons during migration in the mouse. In the first experiment, cellular levels of GnRH mRNA in neurons located throughout the nose and forebrain were examined in embryonic day (E) 12.5, 14.5, 16.5 and 19.5 mice using in situ hybridization. The GnRH mRNA content of cells located in both the nose (p < 0.01) and forebrain (p < 0.05) was found to increase significantly from E12.5 to E19.5 and from E14.5 to E19.5, respectively. However, cellular levels of GnRH mRNA were not significantly different in neurons located in the nose compared with the brain at each developmental age. In the second experiment, levels of GnRH gene transcription were investigated at E14.5 using two different GNLZ transgenic mouse lines in which 13.5 kb of GnRH gene sequences direct the expression of the LacZ reporter to the nucleus of GnRH neurons. Migrating GnRH neurons displayed up to a 3-fold increase (p < 0.01) in transgene expression, an index of GnRH transcription, precisely as they approached and entered the forebrain. These results indicate that GnRH gene expression in migrating GnRH neurons is likely regulated by temporal as well as spatial factors and that, as found postnatally, this may involve both transcriptional and post-transcriptional regulatory mechanisms.

Expression and Function of Gonadotropin-releasing Hormone (GnRH) Receptor in Human Olfactory GnRH-secreting Neurons

“…However, to our knowledge, this is the first report on GnRH-induced cytoskeletal remodeling and migration in human olfactory GnRH-secreting neurons. Migrating GnRH neurons displayed up to a 3-fold increase in GnRH gene expression at the later stages of migration and at the point of entry into the developing forebrain (50). The significance of this increased GnRH production is not yet clear.…”

Disruption of Ephrin Signaling Associates with Disordered Axophilic Migration of the Gonadotropin-Releasing Hormone Neurons

“…The immunocytochemical analysis of embryonic and postnatal mouse brain tissue was undertaken using protocols published previously Simonian and Herbison, 2001b), using antibodies raised against GnRH [1:5000 -1:20,000, LR1; a gift from R. Benoit (Montreal Hospital, Montreal, Quebec, Canada); or 1:10,000, catalog #20075; DiaSorin (Stillwater, MN)], tyrosine hydroxylase (1:4000, MAB318; Chemicon, Temecula, CA), somatostatin (1:3000; a gift from F. Vandesande, Zoological Institute, Leuven, Belgium), choline acetyltransferase (1:5000, AB144; Chemicon), peripherin (1:4000, AB1530; Chemicon), polysialated neural cell adhesion molecule (PSA-NCAM) (1:1000; a gift from G. Rougon, Institute de Biologie du Development, Marseille, France), and the extracellular domain of EphA5 (1:100, E3654; Sigma-Aldrich, Poole, UK). EphA5 immunofluorescence was undertaken by incubating in the goat affinity-purified EphA5 antibody, followed by biotinylated anti-goat IgGs (Vector Laboratories, Peterborough, UK), Vector Elite ABC reagent, and tyramide-Alexa 594 (Molecular Probes, Eugene, OR).…”

“…In situ hybridization was undertaken, also as published previously (Simonian and Herbison, 2001b), using 40 -48 mer 35 S-labeled oligonucleotide probes directed against murine GnRH-I (CTCTTGGAAA-GACTCAACCAAGTGTTCAGTGTTTCTCTTTCCCCC), EphA5 (kinase domain, CACCATCCCGTTTACCATCTGCACCTTCATCTCTT; transmembrane domain, GATGGGAATCTGGCTTTGATCATTAGAT-GCTGCAA; extracellular domain, CTTCACCAATCTCTTCCCACC-CGTTCTTT), ephrin A3 (CCTGATCCACTACGGTGCCTGTCCTA-GAGAGT and GACAAAGAGGGAGGGCACCAAGGGTCAGGGAAA), and ephrin A5 (TGAACACACACATCCAGAGCACCAGAAAGAGCA and CATCAATGTGGTAGTCACCCCTCTGGAATCTGG). Hybridization specificity was determined by comparison between probes and by competition experiments in which a radiolabeled probe was hybridized in the presence of a 25-fold excess of "cold" unlabeled oligonucleotide.…”

The Groucho-related Gene Family Regulates the Gonadotropin-releasing Hormone Gene through Interaction with the Homeodomain Proteins MSX1 and OCT1

“…On this day of prenatal development, the entire population of GnRH neurons has been established, and the cells are migratory, leaving the vomeronasal organ, crossing the cribriform plate to enter the rostroventral forebrain (3). GnRH promoter activity is highly dynamic at this stage (15). It was therefore important to confirm that GRG family members, as candidate cofactors for regulating dynamic promoter activity, co-localize with GnRH neurons at this time point in development.…”

“…Whereas a low level of expression is detected in the nasal region, promoter activity dramatically increases as the neurons enter the anterior forebrain (15). Moreover, GnRH gene expression increases gradually, shortly after birth, preceding the increase in GnRH secretion that drives puberty (16).…”