Regulation of cell proliferation by the antizyme inhibitor: evidence for an antizyme-independent mechanism

Abstract

The antizyme inhibitor was discovered as a protein that binds to the regulatory protein antizyme and inhibits the ability of antizyme to interact with the enzyme ornithine decarboxylase (ODC). Blocking antizyme activity subsequently leads to increased intracellular levels of ODC and increased ODC enzymatic activity. We now report that antizyme inhibitor is a positive modulator of cell growth. Overexpression of antizyme inhibitor in NIH-3T3 mouse fibroblasts or in AT2.1 Dunning rat prostate carcinoma cells resulted in an increased rate of cell proliferation and an increase in saturation density of the cultured cells. This was accompanied by an increase in intracellular levels of the polyamine putrescine. In AT2.1 cells, antizyme inhibitor overexpression also increased the ability of the cells to form foci when grown under anchorage-independent conditions. In order to determine the role of antizyme on antizyme inhibitor activity we created an antizyme inhibitor mutant, AZIΔ117-140, which lacks the putative antizyme-binding domain. We show that this mutant fails to bind to antizyme, but remains capable of inducing increased rates of cell proliferation, suggesting that antizyme inhibitor has antizyme-independent functions. Silencing antizyme inhibitor expression leads to diminished levels of cyclin D1 and to reduced cell proliferation. Antizyme inhibitor is capable of preventing cyclin D1 degradation, and this effect is at least partially independent of antizyme. We show that wild-type antizyme inhibitor and the AZIΔY mutant are capable of direct interaction with cyclin D1 suggesting a potential mechanism for the antizyme-independent effects. Together, our data suggest a novel function for antizyme inhibitor in cellular growth control.

Antizyme, a mediator of ubiquitin-independent proteasomal degradation and its inhibitor localize to centrosomes and modulate centriole amplification

“…Downregulation of antizyme inhibitor activity is associated with reduced cell proliferation (Choi et al, 2005;Kim et al, 2006). Moreover, overexpression of AZI increases cell proliferation and promotes cell transformation (Keren-Paz et al, 2006;Kim et al, 2006) and high levels of AZI have been observed in gastric tumors (Jung et al, 2000). Our results show that overexpression of AZI induces aberrant synthesis of daughter centrioles as reported previously for the papillomavirus-16 E7 oncoprotein (Guarguaglini et al, 2005).…”

“…To address the possibility that regulation of ODC levels and activity may contribute to the centrosome-related activities of antizyme 1/AZI, we also investigated whether inhibition of ODC activity through the specific and irreversible ODC inhibitor difluoromethylornithine (DFMO) may affect centrosome homeostasis. At a DFMO concentration that has been shown to reduce ODC activity without substantial cytostatic activity (Kim et al, 2006), ODC inhibition did not affect centrosome abnormalities (data not shown). This indicates that inhibition of polyamine biosynthesis may not be the principal mechanism by which antizyme 1 and AZI regulate centrosome homeostasis.…”

“…The extra-centrosomal antizyme 1 pools might contribute to this effect as well. Downregulation of antizyme inhibitor activity is associated with reduced cell proliferation (Choi et al, 2005;Kim et al, 2006). Moreover, overexpression of AZI increases cell proliferation and promotes cell transformation (Keren-Paz et al, 2006;Kim et al, 2006) and high levels of AZI have been observed in gastric tumors (Jung et al, 2000).…”

“…AZI is highly homologous to ODC but lacks its enzymatic activity (Murakami et al, 1996). Reduced AZI expression leads to inhibition of cell proliferation (Choi et al, 2005;Kim et al, 2006) and recent data suggest a possible correlation between AZI and malignancy (Jung et al, 2000;Keren-Paz et al, 2006;Kim et al, 2006). In summary, antizyme 1 and AZI act together to regulate ubiquitin-independent degradation of proteins that modulate polyamine metabolism and cell proliferation.…”

Pneumocystis Mediates Overexpression of Antizyme Inhibitor Resulting in Increased Polyamine Levels and Apoptosis in Alveolar Macrophages

“…The sequence of the AZI siRNA was AAGAUCGUGAAGAAGCACAGU, which has been shown to be effective against AZI expression (31). To perform siRNA knockdown, ϳ2 ϫ 10 6 alveolar macrophages were placed in a well of a 6-well plate containing 2 ml of serum-free DMEM.…”