Regulation of Apoptosis by miR-122 in Pterygium via Targeting Bcl-w

Cui, Yu-Hong; Li, Hongyang; Gao, Zi-Xun; Liang, Na; Ma, Sheng-Sheng; Meng, Fan-Jian; Li, Zhijie

doi:10.1167/iovs.16-19402

Cited by 31 publications

(32 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Several reports have revealed the putative contribution of BCL-w in other types of cells. Abundant expression of BCL2L2 was found within the whole epithelium and blood vessels of pterygium, in contrast to the presence of BCL-w protein predominantly in the basal layer of epithelium in normal conjunctiva 88 . Recently, it was also shown that BCL2L2 overexpression contributed to the survival of megakaryocytes and increased formation of platelets 87 .…”

Section: Role Of Bcl-w In Normal Cells and Non-cancer Diseasesmentioning

confidence: 78%

BCL-w: apoptotic and non-apoptotic role in health and disease

Hartman

Czyż

2020

Cell Death Dis

View full text Add to dashboard Cite

The BCL-2 family of proteins integrates signals that trigger either cell survival or apoptosis. The balance between prosurvival and pro-apoptotic proteins is important for tissue development and homeostasis, while impaired apoptosis contributes to several pathologies and can be a barrier against effective treatment. BCL-w is an anti-apoptotic protein that shares a sequence similarity with BCL-X L , and exhibits a high conformational flexibility. BCL-w level is controlled by a number of signaling pathways, and the repertoire of transcriptional regulators largely depends on the cellular and developmental context. As only a few disease-relevant genetic alterations of BCL2L2 have been identified, increased levels of BCL-w might be a consequence of abnormal activation of signaling cascades involved in the regulation of BCL-w expression. In addition, BCL-w transcript is a target of a plethora of miRNAs. Besides its originally recognized pro-survival function during spermatogenesis, BCL-w has been envisaged in different types of normal and diseased cells as an anti-apoptotic protein. BCL-w contributes to survival of senescent and drug-resistant cells. Its non-apoptotic role in the promotion of cell migration and invasion has also been elucidated. Growing evidence indicates that a high BCL-w level can be therapeutically relevant in neurodegenerative disorders, neuron dysfunctions and after small intestinal resection, whereas BCL-w inhibition can be beneficial for cancer patients. Although several drugs and natural compounds can bi-directionally affect BCL-w level, agents that selectively target BCL-w are not yet available. This review discusses current knowledge on the role of BCL-w in health, non-cancerous diseases and cancer.

show abstract

Section: Role Of Bcl-w In Normal Cells and Non-cancer Diseasesmentioning

confidence: 78%

BCL-w: apoptotic and non-apoptotic role in health and disease

Hartman

Czyż

2020

Cell Death Dis

View full text Add to dashboard Cite

show abstract

“…promotes cell invasion, migration, and growth via repression the expression of PTEN, MMP-2 and MMP-9 (32). MiR-122 promotes cell apoptosis and inhibits apoptosis by targeting FOXO and inducing Bcl-w (33,34). Upregulation of miR-24 promotes cell proliferation by targeting MEN1 and regulates cell growth and apoptosis by targeting BCL2 (35,36).…”

Section: Discussionmentioning

confidence: 99%

Reversal of microRNA-blocked tumor suppressors by biphenyldicarboxylate impedes endotoxin-induced hepatic hyperplasia

Tan

Chen

Shen

et al. 2018

Preprint

View full text Add to dashboard Cite

Hepatocellular carcinoma (HCC) is one of the most common malignant tumor and the leading cause of cancer-related death worldwide. Biphenyldicarboxylate (BPDC), an intermediate of schisandrin C from Schisandra chinensis, has been used as a hepatoprotective agent that compromises hepatic injuries in China for decades. Whether BPDC is also implicated in the prevention of HCC remains understood. Here, we report that the bacterial endotoxin lipopolysaccharide (LPS) promotes hepatic inflammation and hyperplasia, during which the common tumor markers, alpha fetoprotein (AFP) and carcinoembryonic antigen (CEA), were unregulated, whereas the tumor suppressors, PTEN, FOXO1 and MEN1, were downregulated through increasing the microRNAs, miR-21, miR-122 and miR-24. In contrast, BPDC dampened hepatic inflammation and hyperplasia accompanied by the upregulation of PTEN, FOXO1 and MEN1 through decreasing miR-21, miR-122 and miR-24. However, BPDC failed to downregulate the tumor marker AEG-1 via increasing miR-195. Taken together, BPDC exerts anti-tumor effects by upregulating tumor suppressors upon decreases of miRNAs rather than downregulating tumor markers by increases of miRNAs.Key words: Biphenyldicarboxylate, lipopolysaccharide, microRNA, tumor suppressor, hepatic inflammation upregulating tumor suppressors rather than downregulating tumor markers/oncogenes.These results should shed light on exploiting the exact mechanism of BPDC in the prevention and treatment of NAFLD and HCC, and would be also beneficial to elucidating the implication of miRNAs in the development of metastasis of hepatic hyperplasia and other hepatic pathogenesis. Materials and methodsAnimals and treatment procedures. Bal b/c mice, belonging to an inbred mouse population, were purchased from the Experimental Animal Centre of Guangzhou University of Chinese Medicine in China (Certificate No. 44005800007512). All mice were housed in a controlled room at the temperature of 24±2°C and the relative humidity of 55%±10% in a 12-h light: 12-h dark cycle with free diet consumption and water drinking. After feeding for one week, mice were randomly divided into three groups: (1) a group of the normal control (NC) of mice; (2) a group of mice administering LPS (LPS); (3) a group of mice given LPS and BPDC (LPS+BPDC).NC mice were intraperitoneally injected with neutral saline. LPS mice were intraperitoneally injected with LPS at 0.25mg/kg every other day for eleven weeks.LPS+BPDC mice were administered BPDC by intragastrical gavage at a dose of 100 mg/kg every day after eight weeks of intraperitoneal injection of LPS. LPS

show abstract

“…Total RNA was isolated from tissues and PTFs with Trizol or Purelink RNA mini kit for reverse transcription and PCR amplification as described previously (Cui et al, ; Li et al, ). PCR primers were as folllows: (a) for MMP‐9, 5′‐GCGTCTTCCCCTTCACTTTC‐3′ (Forward) and 5′‐ATAGGGTACATGAGCGCCTC‐3′ (Reverse); (b) for HuR, 5′‐CCAACTTGTACATCAGCGGG‐3′ (Forward) and 5′‐GGCTGCAAACTTCACTGTGA‐3′ (Reverse); (c) for glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), 5′‐GTCAGTGGTGGACCTGACCT‐3′ (Forward) and 5′‐TGCTGTAGCCAAATTCGTTG‐3′ (Reverse).…”

Section: Methodsmentioning

confidence: 99%

“…bio-rad.com/en-us/product/quantity-one-1-d-analysis-software; RRID:SCR_014280.) 2.12 | RT-PCR and quantitative real-time PCR analysis Total RNA was isolated from tissues and PTFs with Trizol or Purelink RNA mini kit for reverse transcription and PCR amplification as described previously (Cui et al, 2016;Li et al, 2017). PCR primers were as folllows:…”

Section: Gelatin Zymographymentioning

confidence: 99%

Posttranscriptional regulation of MMP‐9 by HuR contributes to IL‐1β‐induced pterygium fibroblast migration and invasion

Cui

Feng

et al. 2019

Journal Cellular Physiology

View full text Add to dashboard Cite

Inflammation is considered to be critical in the pterygium progression and recurrence. However, the underlying molecular mechanism is not well understood. Herein, we investigated the potential role of RNA binding protein human antigen R (HuR) responsible for the impact of inflammation on pterygium development. The expression of HuR and matrix metallopeptidase‐9 (MMP‐9) in pterygium and normal conjunctiva was detected with immunohistochemistry and quantitative reverse transcription polymerase chain reaction (qRT‐PCR). The influence of interleukin‐1β (IL‐1β) on HuR expression and cellular distribution was determined with western blot and immunofluorescence. The pterygium fibroblast (PTF) migration was determined with scratch wound healing assay and Transwell migration assay. MMP‐9 production was determined with qRT‐PCR and gelatin zymography. The interaction between HuR and MMP‐9 was investigated with RNP immunoprecipitation (IP) followed by RT‐PCR and messenger RNA (mRNA) stability analysis. HuR and MMP‐9 expression are elevated in pterygium, especially progressive pterygium compared with normal conjunctiva. IL‐1β could increase the expression and nucleus–cytoplasm shuttle of HuR in cultured PTFs. HuR mediated the stimulatory effect of IL‐1β on PTF migration and MMP‐9 production. HuR bound to MMP‐9 mRNA and in turn increased it stability. Our results suggest that posttranscriptional regulation of MMP‐9 via stabilizing mRNA by HuR might contribute to the stimulatory effect of inflammatory factor IL‐1β on pterygium progression. These findings shed light on the pathogenesis of pterygium and provide a promising target for adjuvant treatment of pterygium.

show abstract

Regulation of Apoptosis by miR-122 in Pterygium via Targeting Bcl-w

Abstract: Decreased expression of miR-122 in pterygium might result in abnormal cell apoptosis via its regulation of the expression of Bcl-w, and subsequently contribute to the development of pterygium.

Cited by 31 publications

References 35 publications

BCL-w: apoptotic and non-apoptotic role in health and disease

BCL-w: apoptotic and non-apoptotic role in health and disease

Reversal of microRNA-blocked tumor suppressors by biphenyldicarboxylate impedes endotoxin-induced hepatic hyperplasia

Posttranscriptional regulation of MMP‐9 by HuR contributes to IL‐1β‐induced pterygium fibroblast migration and invasion

Contact Info

Product

Resources

About