Regulated Intron Removal Integrates Motivational State and Experience

Gill, Jason; Park, Younshim; McGinnis, John P; Pérez-Sánchez, Consuelo; Blanchette, Marco; Si, Kausik

doi:10.1016/j.cell.2017.05.006

Cited by 36 publications

(48 citation statements)

References 78 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this study, next-generation sequencing-based screening of the regulatory targets of nSBs identified a major molecular function of nSBs in promoting intron retention by more than 400 mRNAs during thermal stress recovery. In recent years, a number of studies have examined conditional intron retention in the nucleus and its biological functions, such as regulation of stress responses, the cell cycle, neuronal activity, learning and memory, spermiogenesis, and tumor growth (Boutz et al, 2015, Braun et al, 2017, Dominguez, Tsai et al, 2016, Gill, Park et al, 2017, Mauger et al, 2016, Naro, Jolly et al, 2017. Thus, nuclear intron retention is being accepted as a regulatory mechanism that fine tunes gene expression under various biological conditions.…”

Section: Discussionmentioning

confidence: 99%

LncRNA-dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

Ninomiya

Adachi

Natsume

et al. 2019

Preprint

View full text Add to dashboard Cite

A number of long noncoding RNAs (lncRNAs) are induced in response to specific stresses to construct membrane‐less nuclear bodies; however, their function remains poorly understood. Here, we report the role of nuclear stress bodies (nSBs) formed on highly repetitive satellite III (HSATIII) lncRNAs derived from primate‐specific satellite III repeats upon thermal stress exposure. A transcriptomic analysis revealed that depletion of HSATIII lncRNAs, resulting in elimination of nSBs, promoted splicing of 533 retained introns during thermal stress recovery. A HSATIII‐Comprehensive identification of RNA‐binding proteins by mass spectrometry (ChIRP‐MS) analysis identified multiple splicing factors in nSBs, including serine and arginine‐rich pre‐mRNA splicing factors (SRSFs), the phosphorylation states of which affect splicing patterns. SRSFs are rapidly de‐phosphorylated upon thermal stress exposure. During stress recovery, CDC like kinase 1 (CLK1) was recruited to nSBs and accelerated the re‐phosphorylation of SRSF9, thereby promoting target intron retention. Our findings suggest that HSATIII‐dependent nSBs serve as a conditional platform for phosphorylation of SRSFs by CLK1 to promote the rapid adaptation of gene expression through intron retention following thermal stress exposure.

show abstract

Section: Discussionmentioning

confidence: 99%

LncRNA-dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

Ninomiya

Adachi

Natsume

et al. 2019

Preprint

View full text Add to dashboard Cite

show abstract

“…In recent years, a number of studies have examined conditional intron retention in the nucleus and its biological functions, such as regulation of stress responses, the cell cycle, neuronal activity, learning and memory, spermiogenesis, and tumor growth (Boutz et al, 2015;Dominguez et al, 2016;Mauger et al, 2016;Braun et al, 2017;Gill et al, 2017;Naro et al, 2017). In recent years, a number of studies have examined conditional intron retention in the nucleus and its biological functions, such as regulation of stress responses, the cell cycle, neuronal activity, learning and memory, spermiogenesis, and tumor growth (Boutz et al, 2015;Dominguez et al, 2016;Mauger et al, 2016;Braun et al, 2017;Gill et al, 2017;Naro et al, 2017).…”

Section: Discussionmentioning

confidence: 99%

“…In this study, next-generation sequencing-based screening of the regulatory targets of nSBs identified a major molecular function of nSBs in promoting intron retention by more than 400 mRNAs during thermal stress recovery. In recent years, a number of studies have examined conditional intron retention in the nucleus and its biological functions, such as regulation of stress responses, the cell cycle, neuronal activity, learning and memory, spermiogenesis, and tumor growth (Boutz et al, 2015;Dominguez et al, 2016;Mauger et al, 2016;Braun et al, 2017;Gill et al, 2017;Naro et al, 2017). Thus, nuclear intron retention is being accepted as a regulatory mechanism that fine-tunes gene expression under various biological conditions.…”

Section: Discussionmentioning

confidence: 99%

Lnc RNA ‐dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

et al. 2019

View full text Add to dashboard Cite

A number of long noncoding RNAs (lncRNAs) are induced in response to specific stresses to construct membrane-less nuclear bodies; however, their function remains poorly understood. Here, we report the role of nuclear stress bodies (nSBs) formed on highly repetitive satellite III (HSATIII) lncRNAs derived from primate-specific satellite III repeats upon thermal stress exposure. A transcriptomic analysis revealed that depletion of HSATIII lncRNAs, resulting in elimination of nSBs, promoted splicing of 533 retained introns during thermal stress recovery. A HSATIII-Comprehensive identification of RNAbinding proteins by mass spectrometry (ChIRP-MS) analysis identified multiple splicing factors in nSBs, including serine and argininerich pre-mRNA splicing factors (SRSFs), the phosphorylation states of which affect splicing patterns. SRSFs are rapidly de-phosphorylated upon thermal stress exposure. During stress recovery, CDC like kinase 1 (CLK1) was recruited to nSBs and accelerated the re-phosphorylation of SRSF9, thereby promoting target intron retention. Our findings suggest that HSATIII-dependent nSBs serve as a conditional platform for phosphorylation of SRSFs by CLK1 to promote the rapid adaptation of gene expression through intron retention following thermal stress exposure.

show abstract

“…The qPCR was performed as described in Gill et.al [31] except random hexamer was used for cDNA synthesis. The following primers were used for DptB qPCR: 14 "ACTGGCATATGCTCCCAATTT" and "TCAGATCGAATCCTTGCTTTGG".…”

Section: Quantitative Pcrmentioning

confidence: 99%

Antimicrobial peptides modulate long-term memory

Azpeleta

Weng

et al. 2018

Preprint

Self Cite

View full text Add to dashboard Cite

Antimicrobial peptides act as a host defense mechanism and regulate the commensal microbiome.To obtain a comprehensive view of genes contributing to long-term memory we performed mRNA sequencing from single Drosophila heads following behavioral training that produces long-lasting memory. Surprisingly, we find that two immune peptides with antimicrobial activity, Diptericin B and Gram-Negative Bacteria Binding Protein like 3, regulate long-term but not short-term memory or instinctive behavior in Drosophila. The cellular requirement of these two peptides is distinct: head fat body for DptB, and neurons for GNBP-like3. That antimicrobial peptides influence memory provides a novel example of the emerging link between the immune and nervous systems and reveals that some immune peptides may have been repurposed in the nervous system. Author summaryIt is becoming evident that the nervous system and immune system share not only some of the same molecular logic but also the same components. Here, we report a novel and unanticipated example of how immune genes influence nervous system function. During exploring how Drosophila form longlasting memories of certain experiences, we have found that antimicrobial peptides that fight bacteria in the body, are expressed in the head, and control whether an animal would form long-term memory of a food source or a mating partner. Antimicrobial peptides are detected in the brain of many species and has often been associated with dysfunction of the nervous system. This and other recent works, provide an explanation to why antimicrobial peptides may be expressed in the brain: they regulate normal functions of the brain. Both eating, and mating engage the immune system in preparation of exposure to external agents including bacteria. We speculate antimicrobial peptides were upregulated in the body to deal with immune challenges and over evolutionary time some of them are co-adopted to convey specific information about food or mating to the brain.

show abstract

Regulated Intron Removal Integrates Motivational State and Experience

Cited by 36 publications

References 78 publications

LncRNA-dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

LncRNA-dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

Lnc RNA ‐dependent nuclear stress bodies promote intron retention through SR protein phosphorylation

Antimicrobial peptides modulate long-term memory

Contact Info

Product

Resources

About