Regulated appearance of NMDA receptor subunits and channel functions during in vitro neuronal differentiation

Abstract

The schedule of NMDA receptor subunit expression and the appearance of functional NMDA-gated ion channels were investigated during the retinoic acid (RA) induced neuronal differentiation of NE-4C, a p53-deficient mouse neuroectodermal progenitor cell line. NR2A, NR2B, and NR2D subunit transcripts were present in both nondifferentiated and neuronally differentiated cultures, while NR2C subunits were expressed only transiently, during the early period of neural differentiation. Several splice variants of NR1 were detected in noninduced progenitors and in RA-induced cells, except the N1 exon containing transcripts that appeared after the fourth day of induction, when neuronal processes were already formed. NR1 and NR2A subunit proteins were detected both in nondifferentiated progenitor cells and in neurons, while the mature form of NR2B subunit protein appeared only at the time of neuronal process elongation. Despite the early presence of NR1 and NR2A subunits, NMDA-evoked responses could be detected in NE-4C neurons only after the sixth day of induction, coinciding in time with the expression of the mature NR2B subunit. The formation of functional NMDA receptors also coincided with the appearance of synapsin I and synaptophysin. The lag period between the production of the subunits and the onset of channel function suggests that subunits capable of channel formation cannot form functional NMDA receptors until a certain stage of neuronal commitment. Thus, the in vitro neurogenesis by NE-4C cells provides a suitable tool to investigate some inherent regulatory processes involved in the initial maturation of NMDA receptor complexes.

Retinoid Machinery in Distinct Neural Stem Cell Populations with Different Retinoid Responsiveness

“…If induced by all-trans RA, NE-4C cells develop into neurons and glial cells through well characterized stages of differentiation, including transient states of radial glia like development characterized with Pax6 and Emx2 expression and RC2-immunopositivity [29,33,41,42]. Mature neurons with synapsin expression and specific machinery for neurotransmitter production, release and uptake develop by the 9-10th day after RA induction [31].…”

“…For this purpose, neural stem cells cloned from early embryonic (E9) mouse neuroectoderm (NE-4C cells; [29][30][31][32][33][34]) and stem/progenitor cells isolated from late embryonic (E14.5) or adult (P62) neurogenic zones (RGl cells; [35]) were used. The results demonstrated that the investigated stem/ progenitor populations showed significant differences in many aspects of both RA metabolism and retinoid responsiveness.…”

Immunosuppression by N-Methyl-d-Aspartate Receptor Antagonists Is Mediated through Inhibition of Kv1.3 and KCa3.1 Channels in T Cells

“…RNA from brain, thymocytes, and peripheral T cells was isolated with TRIzol reagent (Life Technologies, Darmstadt, Germany) and reverse transcribed with a First-Strand cDNA Synthesis kit (Thermo Scientific, Karlsruhe, Germany). Oligonucleotides for reverse transcription-PCR (RT-PCR) and PCR, obtained from Apara Bioscience GmbH, Denzlingen, Germany, were as follows: Fwd-␤-actin (5=-CCAGG TCATCACTATTGGCAAGGA-3=), Rev-␤-actin (5=-GAGCAGTAATCT CCTTCTGCATCC), Fwd-GAPDH (5=-CAAGGTCATCCATGACAACT TTG), Rev-GAPDH (3= GTCCACCACCCTGTTGCTGTAG), FwdGluN1C1 (5=-TGTGTCCCTGTCCATACTCAAG-3=), Rev-GluN1C1 (5=-GTCGGGCTCTGCTCTACCACTC-3=), Fwd GluN2A (5=-GGAGAA GGGTACTCCAGCGCTGAA-3=), Rev GluN2A (5=-AGTCTGTGAGGA GATAAAATCCAGC-3=), Fwd-GluN2B (5=-GCAAGCTTCTGTCATGC TCAACATC-3=), and Rev-GluN2B (5=-GCTCTGCAGCTTCTTCAGCT GATTC-3=) (20). wt and floxed GluN1 alleles and GluN1 excision were analyzed by PCR using DNA isolated from tail, thymocytes, or brain; primers used were as follows: forward (Fwd) primer 5=-CTGGGACTCA GCTGTGCTGG-3= and reverse (Rev) primer 5=-AGGGGAGGCAACAC TGTGGAC-3= for GluN1 flox/wt and Fwd primer 5=-GAGAAAGACATGG GGCATTATCC-3= for GluN1 excision.…”

Glutamate and Regulation of Proliferation in the Developing Mammalian Telencephalon

“…In our previous work, we have noted NMDA receptors in proliferating neuroblasts from the ventral telencephalon germinal zones [Luk et al, 2003]. Interestingly, mRNA for the NR1 subunit of the NMDA receptor has been detected in multipotent forebrain precursors in vitro [Maric et al, 2000;Varju et al, 2001;Jelitai et al, 2002]. The observation that glutamate fails to influence proliferation and/or survival in early stem cell populations while influencing more differentiated neuroblasts could indicate that nonresponsive subpopulations lack functional receptor expression or downstream cellular pathways which couple receptor activation with proliferation [Maric et al, 2000].…”