Regeneration in pig livers by compensatory hyperplasia induces high levels of telomerase activity

Abstract

Background: Several highly proliferative human cells transiently activate telomerase, a ribonucleoprotein with reverse transcriptase activity, to counterbalance replication-associated telomere erosion and to increase stress resistance. Quiescent human hepatocytes exhibit very low or undetectable levels of telomerase activity. However, hepatocytes display a remarkable proliferative capability following liver injury. To investigate whether liver regeneration by compensatory hyperplasia is associated with telomerase activation, we measured telomerase activity in pig livers after 70 to 80% partial hepatectomy using a fully quantitative real-time telomeric repeat amplification protocol. In contrast to commonly studied inbred laboratory mouse strains, telomere length and telomerase activity in porcine tissues are comparable to humans.

Age-associated Change of C/EBP Family Proteins Causes Severe Liver Injury and Acceleration of Liver Proliferation after CCl4 Treatments

“…It is important to note that our data for TERT-mediated inhibition of liver proliferation in livers of old mice after CCl 4 treatment do not support previous observations obtained in studies of liver regeneration after partial hepatectomy (PH). It has been shown that TERT activity was increased after PH in pig's livers (31) and that hTERT promoter is activated during liver proliferation in mouse hepatocytes (32). However, our data with CCl 4 -mediated liver proliferation in livers of old mice showed that the reduction of TERT is involved in the increased liver proliferation.…”

Forced Activation of β-Catenin Signaling Supports the Transformation of hTERT-Immortalized Human Fetal Hepatocytes

“…For the qPCR protocol described above, a validated primer set for hTERT (sc-156050-PR; Santa Cruz Biotechnology), a self-designed and optimized primer set for hTERC (GCCTTCCACCGTTCATTCTA and GGCZGACA-GAGCCCAACTC) and the basket housekeeper were used. Telomerase activity in extracts from 1,000 cells was measured and expressed as relative telomerase activity (RTA) in comparison with telomerase-positive 293T cells with the real-time quantitative telomeric repeat amplification protocol (RQ-TRAP) as outlined before (28).…”

Human telomerase activity, telomerase and telomeric template expression in hepatic stem cells and in livers from fetal and postnatal donors

“…The observed DNA synthesis is followed by cytokinesis leading to complete cell division in all cells after toxic injury, but cytokinesis occurs in only a subpopulation of the parenchymal cells following PH. PH is associated with an increase in overall telomerase activity in mouse and pig (21, 22). In our studies we show that hHpSCs do not increase telomerase activity in response to short exposure times to growth factors.…”

“…The complete liver mass is restored within a week. Increased telomerase activity has been observed 24h after PH in the total parenchymal cell population of mice (21) and pigs (22); pretreatment of mice with EGF and HGF resulted in increased telomerase activity in vivo after PH.…”