Redundancy and Complementarity between ERAP1 and ERAP2 Revealed by their Effects on the Behcet's Disease-associated HLA-B*51 Peptidome*[S]

Guasp, Pablo; Lorente, Elena; Martín-Esteban, Adrián; Barnea, Eilon; Romania, Paolo; Fruci, Doriana; Kuiper, Jonas J.W.; Admon, Arie; Castro, José A. Łópez de

doi:10.1074/mcp.ra119.001515

Cited by 20 publications

(21 citation statements)

References 90 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In HLA-B*51:01, which virtually does not bind peptides with basic P1 residues, the main effect of ERAP2 expression, when ERAP1 was also present, was not on P1 residue usage but instead on an increased abundance of 8-mers, relative to 9-mers and longer peptides. This study (20) also showed that, in the absence of ERAP1, ERAP2 is able to process HLA-B*51 ligands in the ER, revealing a degree of functional redundancy, which is only evident upon absence of ERAP1. These previous studies show that the effect of ERAP2 on MHC-I peptidomes, although significant in all cases, is strongly dependent on the peptide specificity of each particular MHC-I molecule.…”

supporting

confidence: 52%

See 1 more Smart Citation

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis

Lorente

Redondo-Antón

Martín-Esteban

et al. 2019

Molecular & Cellular Proteomics

Self Cite

View full text Add to dashboard Cite

ERAP2 and HLA-B*40:02 are associated with ankylosing spondylitis independently of HLA-B*27. ERAP2 process MHC-I ligands, preferentially trimming N-terminal basic residues. The B*40:02 peptidomes from wild-type and ERAP2-KO cells were compared, which demonstrated a substantial role of ERAP2 on the generation/destruction balance of HLA-B*40:02 ligands. The major effect was on N-terminal residues, although other peptide positions were also affected. We propose that the non-epistatic association of ERAP2 with spondyloarthropathy might be related to processing of peptides with N-terminal basic residues.

show abstract

supporting

confidence: 52%

“…The influence of ERAP2 on MHC-I-bound peptidomes has been examined so far in HLA-B*27:05 (17,18), A*29:02 (19), and HLA-B*51:01 (20). The B*27:05 peptidome shows a relatively high frequency of peptides with basic P1 residues, and the overwhelming majority of HLA-B*27 ligands have R at P2.…”

mentioning

confidence: 99%

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis

Lorente

Redondo-Antón

Martín-Esteban

et al. 2019

Molecular & Cellular Proteomics

Self Cite

View full text Add to dashboard Cite

show abstract

“…and Int_Rv (ACTTGTTACGTGCCTAGACCT). Transfected cells were cloned and the ERAP2 expression was analyzed by PCR and Western Blot as previously described (31). Two unedited (UN17, and UN20 with the complete ERAP2 sequence) and two homozygously edited (KO9, and KO19 without the ERAP2 exons 5 and 6) cell clones were selected.…”

Section: Downloaded Frommentioning

confidence: 99%

Modulation of Natural HLA-B*27:05 Ligandome by Ankylosing Spondylitis-associated Endoplasmic Reticulum Aminopeptidase 2 (ERAP2)

Lorente¹,

Fontela²,

Barnea

et al. 2020

Molecular & Cellular Proteomics

Self Cite

View full text Add to dashboard Cite

The HLA-B*27:05 allele and the endoplasmic reticulum-resident aminopeptidases are strongly associated with AS, a chronic inflammatory spondyloarthropathy. This study examined the effect of ERAP2 in the generation of the natural HLA-B*27:05 ligandome in live cells. Complexes of HLA-B*27:05-bound peptide pools were isolated from human ERAP2-edited cell clones, and the peptides were identified using high-throughput mass spectrometry analyses. The relative abundance of a thousand ligands was established by quantitative tandem mass spectrometry and bioinformatics analysis. The residue frequencies at different peptide position, identified in the presence or absence of ERAP2, determined structural features of ligands and their interactions with specific pockets of the antigen-binding site of the HLA-B*27:05 molecule. Sequence alignment of ligands identified with species of bacteria associated with HLA-B*27-dependent reactive arthritis was performed. In the absence of ERAP2, peptides with N-terminal basic residues and minority canonical P2 residues are enriched in the natural ligandome. Further, alterations of residue frequencies and hydrophobicity profile at P3, P7, and PΩ positions were detected. In addition, several ERAP2-dependent cellular peptides were highly similar to protein sequences of arthritogenic bacteria, including one human HLA-B*27:05 ligand fully conserved in a protein from Campylobacter jejuni. These findings highlight the pathogenic role of this aminopeptidase in the triggering of AS autoimmune disease.

show abstract

“…The most frequent alleles resulted A*02 (38 pts) and A*01 (25 pts) for the locus A; B*18 (20 pts) and B*35 (20 pts) for the locus B; C*07 (43 pts) and C*04 (27 pts) for the locus C and DRB1*11(36 pts) and DRB1*03 (20 pts) for DRB1. In our analysis, we also included allele HLA-B*51 (17 pts) for its known correlation with common autoimmune diseases 15. Allele homozygosis for the loci A, B, C and DRB1 was detected in 10, 4, 11 and 13 patients, respectively.…”

mentioning

confidence: 99%

Distinctive germline expression of class I human leukocyte antigen (HLA) alleles and DRB1 heterozygosis predict the outcome of patients with non-small cell lung cancer receiving PD-1/PD-L1 immune checkpoint blockade

Correale¹,

Saladino

Giannarelli

et al. 2020

J Immunother Cancer

View full text Add to dashboard Cite

BackgroundNivolumab is a human monoclonal antibody against programmed cell death receptor-1 (PD-1) able to rescue quiescent tumor infiltrating cytotoxic T lymphocytes (CTLs) restoring their ability to kill target cells expressing specific tumor antigen-derived epitope peptides bound to homologue human leukocyte antigen (HLA) molecules. Nivolumab is currently an active but expensive therapeutic agent for metastatic non-small cell lung cancer (mNSCLC), producing, in some cases, immune-related adverse events (irAEs). At the present, no reliable biomarkers have been validated to predict either treatment response or adverse events in treated patients.MethodsWe performed a retrospective multi-institutional analysis including 119 patients with mNSCLC who received PD-1 blockade since November 2015 to investigate the predictive role of germinal class I HLA and DRB1 genotype. We investigated the correlation among patients’ outcome and irAEs frequency with specific HLA A, B, C and DRB1 alleles by reverse sequence-specific oligonucleotide (SSO) DNA typing.ResultsA poor outcome in patients negative for the expression of two most frequent HLA-A alleles was detected (HLA: HLA-A*01 and or A*02; progression-free survival (PFS): 7.5 (2.8 to 12.2) vs 15.9 (0 to 39.2) months, p=0.01). In particular, HLA-A*01-positive patients showed a prolonged PFS of 22.6 (10.2 to 35.0) and overall survival (OS) of 30.8 (7.7 to 53.9) months, respectively. We also reported that HLA-A and DRB1 locus heterozygosis (het) were correlated to a worse OS if we considered het in the locus A; in reverse, long survival was correlated to het in DRB1.ConclusionsThis study demonstrate that class I and II HLA allele characterization to define tumor immunogenicity has relevant implications in predicting nivolumab efficacy in mNSCLC and provide the rationale for further prospective trials of cancer immunotherapy.

show abstract

Redundancy and Complementarity between ERAP1 and ERAP2 Revealed by their Effects on the Behcet's Disease-associated HLA-B51 Peptidome[S]

Cited by 20 publications

References 90 publications

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis

Modulation of Natural HLA-B*27:05 Ligandome by Ankylosing Spondylitis-associated Endoplasmic Reticulum Aminopeptidase 2 (ERAP2)

Distinctive germline expression of class I human leukocyte antigen (HLA) alleles and DRB1 heterozygosis predict the outcome of patients with non-small cell lung cancer receiving PD-1/PD-L1 immune checkpoint blockade

Contact Info

Product

Resources

About

Redundancy and Complementarity between ERAP1 and ERAP2 Revealed by their Effects on the Behcet's Disease-associated HLA-B*51 Peptidome*[S]

Cited by 20 publications

References 90 publications

Substantial Influence of ERAP2 on the HLA-B*40:02 Peptidome: Implications for HLA-B*27-Negative Ankylosing Spondylitis

Substantial Influence of ERAP2 on the HLA-B*40:02 Peptidome: Implications for HLA-B*27-Negative Ankylosing Spondylitis

Modulation of Natural HLA-B*27:05 Ligandome by Ankylosing Spondylitis-associated Endoplasmic Reticulum Aminopeptidase 2 (ERAP2)

Distinctive germline expression of class I human leukocyte antigen (HLA) alleles and DRB1 heterozygosis predict the outcome of patients with non-small cell lung cancer receiving PD-1/PD-L1 immune checkpoint blockade

Contact Info

Product

Resources

About

Redundancy and Complementarity between ERAP1 and ERAP2 Revealed by their Effects on the Behcet's Disease-associated HLA-B51 Peptidome[S]

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis

Substantial Influence of ERAP2 on the HLA-B40:02 Peptidome: Implications for HLA-B27-Negative Ankylosing Spondylitis