Reduced expression of hepatocyte growth factor activator inhibitor type‐2/placental bikunin (HAI‐2/PB) in human glioblastomas: Implication for anti‐invasive role of HAI‐2/PB in glioblastoma cells

Hamasuna, Ryouichi; Kataoka, Hiroaki; Jingyan, Meng; Itoh, Hiroshi; Moriyama, Takuzou; Wakisaka, Shinichiro; Koono, Masashi

doi:10.1002/ijc.1349.abs

Cited by 17 publications

(31 citation statements)

References 11 publications

(14 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Primers were designed using the program PrimerQuest (www.idtdna.com) or primer 3, unless otherwise stated. Primer sequences and lengths of products were: G3PDH-F, GTGAAGGTCGGAG TCAACGGA; G3PDH-3, GGTGAAGACGCCAGTGGACTC (300 bp) (20); Wnt10B-5, GCCATCCTCAAGCGCGGTTTC; Wnt10B-3, GAATCCAAGAAATCCCGAGAG (326 bp) (21); Wnt10B probe, CTGTGGCTGGAAGGGCAGTG; Wnt5AF, GGGGAAATGTGGTTTAATGGTG; and Wnt5AR, AAAT GGAGGTTGGAGACAAAGG (368 bp).…”

Section: Quantitative Real-time Pcr (Q-pcr)mentioning

confidence: 99%

Expression of Wnt5A and Wnt10B in non-immortalized breast cancer cells

Fernandez-Cobo

Zammarchi²,

Mandeli³

et al. 2007

Oncol Rep

View full text Add to dashboard Cite

Abstract. Wnt signaling is usually divided into two pathways: the 'canonical', acting through ß-catenin, and the 'noncanonical' acting through the Ca 2+ and planar cell polarity pathway. Both pathways have been implicated in different types of cancer. Most results obtained with established cell lines have been contradictory. Here, we have investigated the expression of Wnt10B (canonical) and Wnt5A (non-canonical) in a panel of finite life-span and established normal and breast cancer cells using quantitative RT-PCR. It was found that there were both significant overexpression of Wnt5A and underexpression of Wnt10B in the metastasis-derived finite life-span breast cancer cells when they were compared to the finite life-span normal and established normal and breast tumor cells. Since expression profiles of primary breast cancer cultures are closer to the original tumor than the established cell lines, future research in this area should take into consideration these differences.

show abstract

Section: Quantitative Real-time Pcr (Q-pcr)mentioning

confidence: 99%

Expression of Wnt5A and Wnt10B in non-immortalized breast cancer cells

Fernandez-Cobo

Zammarchi²,

Mandeli³

et al. 2007

Oncol Rep

View full text Add to dashboard Cite

show abstract

“…This indicates an exclusive role for ITI H2 in the control of cell invasion that is independent from bikunin. In addition to the invasion assays used here, bikunin has also been previously examined in glioma cell migration models where transient overexpression of placental bikunin alone did not significantly affect migration despite an inverse correlation of primary tumor mRNA levels with malignancy (23). Therefore, it is reasonable to assume that the ITI H2 isolated and identified in our purified fractions is individually responsible for the inhibitory effects on glioma cell invasion rather than the covalently bound bikunin.…”

Section: Discussionmentioning

confidence: 96%

Isolation of a Natural Inhibitor of Human Malignant Glial Cell Invasion: Inter α-Trypsin Inhibitor Heavy Chain 2

et al. 2006

View full text Add to dashboard Cite

Malignant central nervous system (CNS) tumors, such as glioblastoma multiforme, invade the brain and disrupt normal tissue architecture, making complete surgical removal virtually impossible. Here, we have developed and optimized a purification strategy to isolate and identify natural inhibitors of glioma cell invasion in a three-dimensional collagen type I matrix. Inter A-trypsin inhibitor heavy chain 2 (ITI H2) was identified from the most inhibitory fractions and its presence was confirmed both as a single protein and in a bikunin-bound form. Stable overexpression in U251 glioma cells validated ITI H2's strong inhibition of human glioma cell invasion together with significant inhibition of cell proliferation and promotion of cell-cell adhesion. Analysis of primary human brain tumors showed significantly higher levels of ITI H2 in normal brain and low-grade tumors compared with high-grade gliomas, indicating an inverse correlation with malignancy. The phosphatidylinositol 3-kinase/Akt signaling cascade seemed to be one of the pathways involved in the effect of ITI H2 on U251 cells. These findings suggest that reduction of ITI H2 expression correlates with brain tumor progression and that targeting factors responsible for its loss or restoring the ITI supply exogenously may serve as potential therapeutic strategies for a variety of CNS tumors. (Cancer Res 2006; 66(3): 1464-72)

show abstract

“…[15][16][17]19,25,39 Previous study has shown that KD-1 was the major functional domain in HAI-2 in inhibiting the activity of its target proteases in vitro. 6 However, the roles of the 2 KDs of HAI-2 in tumour suppressive functions have not been clarified.…”

Section: Discussionmentioning

confidence: 99%

“…[11][12][13] HAI-2 has been found to be underexpressed in several types of cancers such as breast cancer, 14 renal-cell carcinoma, 15,16 and glioblastoma. 17,18 Ectopic expression of HAI-2 was able to suppress tumour cell growth in vitro in renal-cell carcinoma 16 and inhibit cell migration and/or invasion in breast and renal-cell carcinoma. 16,19 However, the roles of HAI-2 in human HCC have not been fully characterised.…”

mentioning

confidence: 99%

HAI‐2 is epigenetically downregulated in human hepatocellular carcinoma, and its Kunitz domain type 1 is critical for anti‐invasive functions

Tung

Wong

Yau

et al. 2009

Intl Journal of Cancer

View full text Add to dashboard Cite

Pharmacological demethylation-based gene expression profile analysis is a useful tool to identify epigenetically silenced tumour suppressor genes. HGF activator inhibitor 2 (HAI-2), a serine protease inhibitor, has been identified as one of the candidate tumour suppressor genes in human hepatocellular carcinoma (HCC) with this technique. In this study, we aimed to characterise the epigenetic status and tumour suppressive function of HAI-2 in HCC. We validated that HAI-2 expression was either absent or low in most of the HCC cell lines tested, and 5-Aza-2 0 -deoxycytidine treatment significantly restored its expression in 9 (75%) of these 12 cell lines. HAI-2 was found to be frequently underexpressed in human HCCs (p < 0.001). With bisulphite DNA sequencing and methylation-specific PCR, we found that the promoter of the HAI-2 gene was frequently hypermethylated in both HCC cell lines and human HCCs. Ectopic expression of HAI-2 significantly inhibited cell migration and invasiveness of HCC cells in vitro and suppressed tumourigenicity in vivo. In addition, we also provided the first evidence that HAI-2 mediated its tumour suppressor function via the Kunitz domain 1 (KD-1), as KD-1 but not KD-2 inactivating mutant abolished its anti-tumour invasiveness in vitro. Our findings suggest that HAI-2 is a candidate tumour suppressor gene that is frequently hypermethylated and underexpressed in human HCCs, and the KD-1 domain of HAI-2 is the key region responsible for its anti-invasive function. '

show abstract

Reduced expression of hepatocyte growth factor activator inhibitor type‐2/placental bikunin (HAI‐2/PB) in human glioblastomas: Implication for anti‐invasive role of HAI‐2/PB in glioblastoma cells

Cited by 17 publications

References 11 publications

Expression of Wnt5A and Wnt10B in non-immortalized breast cancer cells

Expression of Wnt5A and Wnt10B in non-immortalized breast cancer cells

Isolation of a Natural Inhibitor of Human Malignant Glial Cell Invasion: Inter α-Trypsin Inhibitor Heavy Chain 2

HAI‐2 is epigenetically downregulated in human hepatocellular carcinoma, and its Kunitz domain type 1 is critical for anti‐invasive functions

Contact Info

Product

Resources

About