Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles

Manjarrés, Isabel M.; Chamero, Pablo; Domingo, Beatriz; Molina, F.; Llopis, Juan; Alonso, Marı́a Teresa; García‐Sancho, Javier

doi:10.1007/s00424-007-0349-5

Cited by 55 publications

(70 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Miro1 shRNAi (V2MM_72258, TGCTGTTGACAGTGAGCGCCCTGATTGCACTACTGAATTA TAGTGAAGCCACAGATGTA TAATTCAGTAGTGCAATCAGGATGCCTACT GCCTCGGA; and a control scrambled sequence) was provided by Josef Kittler (UCL, London). The mitochondrial-targeted aequorin and mito-PAGFP were as previously described 27,29 . MitDsRed was a gift from Antonio Zorzano (IRB Barcelona).…”

Section: Discussionmentioning

confidence: 99%

“…3c-e), indicate that this protein is not involved in the regulation of bioenergetic mitochondrial parameters. To examine whether Alex3 controls mitochondrial Ca 2 + handling 26 , we transfected cells with a mitochondria-targeted aequorin/GFP fusion protein 27 , and measured mitochondrial uptake of Ca 2 + . Our data show that neither the uptake of Ca 2 + released from the endoplasmic recticulum (ER) by stimulation with ATP + carbachol nor mitochondrial Ca 2 + uptake by cells whose plasma membrane had been permeabilized by treatment with digitonin was altered by the overexpression of Alex3 (Fig.…”

Section: Armcx and Armc10 Genes Encode For Mitochondrial Proteinsmentioning

confidence: 99%

See 1 more Smart Citation

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

et al. 2012

Self Cite

View full text Add to dashboard Cite

Brain function requires neuronal activity-dependent energy consumption. neuronal energy supply is controlled by molecular mechanisms that regulate mitochondrial dynamics, including Kinesin motors and mitofusins, miro1-2 and Trak2 proteins. Here we show a new protein family that localizes to the mitochondria and controls mitochondrial dynamics. This family of proteins is encoded by an array of armadillo (Arm) repeat-containing genes located on the X chromosome. The Armcx cluster is unique to Eutherian mammals and evolved from a single ancestor gene (Armc10). We show that these genes are highly expressed in the developing and adult nervous system. Furthermore, we demonstrate that Armcx3 expression levels regulate mitochondrial dynamics and trafficking in neurons, and that Alex3 interacts with the Kinesin/miro/Trak2 complex in a Ca 2 + -dependent manner. our data provide evidence of a new Eutherian-specific family of mitochondrial proteins that controls mitochondrial dynamics and indicate that this key process is differentially regulated in the brain of higher vertebrates.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Armcx and Armc10 Genes Encode For Mitochondrial Proteinsmentioning

confidence: 99%

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

et al. 2012

Self Cite

View full text Add to dashboard Cite

show abstract

“…The N604S mutation (26), which is unglycosylated, was introduced using the following forward oligonucleotide: 5Ј-ATTGAGGATGG-GAAGAGTAACTCTCTGCCTATGG-3Ј; for the mutant K155A (7), the forward oligonucleotide 5Ј-AGACCCAGAGA-CAGGAGCGACCTGTCTGCTAAAAG-3Ј was used; for the mutant R181A, the forward oligonucleotide 5Ј-CTCCTGGA-CGTTGCCGCGAAGACAGACAGCCTGAAG-3Ј was used; and for the mutant lacking amino acids 767-801 near the C terminus (⌬35AA) (5), the forward oligonucleotide 5Ј-CGAG-ATAGACATGCCACCCAGCAGGAAGAAGTTC-3Ј and the reverse oligonucleotide 5Ј-ACAGTTGCCTGGGTCCTCGT-TGATGATACCCAC-3Ј were used. The vector pHSVermutRA containing the red fluorescent protein fused to mutated aequorin was used here as an ER marker (27).…”

Section: Methodsmentioning

confidence: 99%

The Endoplasmic Reticulum of Dorsal Root Ganglion Neurons Contains Functional TRPV1 Channels

Gallego-Sandı́n¹,

Rodrı́guez-Garcı́a²,

Alonso

et al. 2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

(4). Calmodulin (CaM) seems to be involved in this process through two CaM binding sites located one at the C-terminal (5) and the other at the ankyrin repeat domain in the N-terminal end of the protein (6, 7). Deletion of these sites relieves TRPV1 desensitization and tachyphylaxis. Other factors that can modulate the activity of TRPV1 are changes of pH or temperature, inflammatory mediators, and phosphorylation (8). These modulators may be involved in sensitization to pain. A large part of TRPV1 naturally expressed in DRG neurons locates in endomembranes rather than in the plasma membrane (9 -12), and a similar situation has been reported for other TRP channels. The function of these endomembrane channels is not known, although it has been speculated that they may represent a reserve pool that could be rapidly mobilized to the plasma membrane when required (13). In this direction, it has been reported that activation of protein kinase C (14), nerve growth factor-induced phosphorylation via Src kinase (15) or coupling with phosphoinositide 3-kinase (16) promotes insertion of ER-located TRPV1 channels (TRPV1 ER ) into the plasma membrane (TRPV1 PM ). This mobilization could be the basis of inflammatory sensitization and hyperalgesia.On the other hand, previous work has shown that TRPV1 ER channels are functional (9 -12, 17) and that its activation leads to alterations of ER and mitochondria, followed by cell death (9, 18). Cell death due to ER stress following ER Ca 2ϩ emptying by TRPV1 ER stimulation has also been documented in human lung cells (19). Transfection of HEK293T cells with TRPV1 reproduces the neuronal model with expression of functional TRPV1 ER and TRPV1 PM channels (9,16,18,20,21).In all of the previous studies, the effects of TRPV1 on [Ca 2ϩ ] ER were inferred from the changes of the cytosolic Ca 2ϩ concentration ([Ca 2ϩ ] C ). We can now monitor directly [Ca 2ϩ ] ER in living cells using ER-targeted aequorins (22-24). Here we have studied in detail the release of Ca 2ϩ from ER induced by activation of TRPV1 in DRG neurons and in HEK293T cells expressing TRPV1 channels.

show abstract

“…cofactor celenterazine, emitted bioluminescence (22). Interestingly, some of the GFP fusions without the cofactor exhibited Ca 2+ -dependent fluorescence, and hence could potentially be used as fluorescent Ca 2+ probes.…”

Section: Significancementioning

confidence: 99%

“…To test the ability of GAP to monitor subcellular Ca 2+ dynamics, we targeted it to distinct compartments. Expression in the cytosol, the nucleus, or mitochondria was achieved by using the specific targeting sequences previously reported for aequorin (22,25) from stimuli known to release Ca 2+ from the intracellular stores. The ATP challenge also provoked a transient increase in the mitochondrial Ca 2+ ([Ca 2+ ] M ), which was reversibly prevented by mitochondrial depolarization with trifluorocarbonylcyanidephenylhydrazone (FCCP) (Fig.…”

Section: Significancementioning

confidence: 99%

GAP, an aequorin-based fluorescent indicator for imaging Ca ²⁺ in organelles

Rodrı́guez-Garcı́a

Rojo-Ruiz

Navas-Navarro

et al. 2014

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Genetically encoded calcium indicators allow monitoring subcellular Ca 2+ signals inside organelles. Most genetically encoded calcium indicators are fusions of endogenous calcium-binding proteins whose functionality in vivo may be perturbed by competition with cellular partners. We describe here a novel family of fluorescent Ca 2+ sensors based on the fusion of two Aequorea victoria proteins, GFP and apo-aequorin (GAP). GAP exhibited a unique combination of features: dual-excitation ratiometric imaging, high dynamic range, good signal-to-noise ratio, insensitivity to pH and Mg 2+ , tunable Ca 2+ affinity, uncomplicated calibration, and targetability to five distinct organelles. Moreover, transgenic mice for endoplasmic reticulum-targeted GAP exhibited a robust long-term expression that correlated well with its reproducible performance in various neural tissues. This biosensor fills a gap in the actual repertoire of Ca 2+ indicators for organelles and becomes a valuable tool for in vivo Ca 2+ imaging applications.calcium signalling | Golgi apparatus | hippocampus | motor neuron

show abstract

Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles

Cited by 55 publications

References 28 publications

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

The Endoplasmic Reticulum of Dorsal Root Ganglion Neurons Contains Functional TRPV1 Channels

GAP, an aequorin-based fluorescent indicator for imaging Ca ²⁺ in organelles

Contact Info

Product

Resources

About

Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles

Cited by 55 publications

References 28 publications

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

The Endoplasmic Reticulum of Dorsal Root Ganglion Neurons Contains Functional TRPV1 Channels

GAP, an aequorin-based fluorescent indicator for imaging Ca 2+ in organelles

Contact Info

Product

Resources

About

GAP, an aequorin-based fluorescent indicator for imaging Ca ²⁺ in organelles