Recombinant Semliki Forest virus vectors encoding hepatitis B virus small surface and pre‐S1 antigens induce broadly reactive neutralizing antibodies

Niedre-Otomere, Baiba; Bogdanova, Ance; Skrastiņa, Dace; Zajakina, Anna; Brüvere, Rüta; Ose, Velta; Gerlich, Wolfram H.; Garoff, Henrik; Pumpens, Paul; Glebe, Dieter; Kozlovska, Tatjana

doi:10.1111/j.1365-2893.2012.01594.x

Cited by 8 publications

(9 citation statements)

References 46 publications

(81 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All kinds of viral vectors were considered as potential carriers for the HBs and preS gene, e.g. Semliki forest virus with promising preliminary results [132], but none of these have ever entered human trials. After almost 30 years of recombinant hepatitis B vaccines some of their deficits are now quite apparent, but the only recognizable progress in practice is the introduction of stronger adjuvants for certain groups of weak responders.…”

Section: Vaccinationmentioning

confidence: 99%

Medical Virology of Hepatitis B: how it began and where we are now

Gerlich

2013

Virol J

277

229

View full text Add to dashboard Cite

Infection with hepatitis B virus (HBV) may lead to acute or chronic hepatitis. HBV infections were previously much more frequent but there are still 240 million chronic HBV carriers today and ca. 620,000 die per year from the late sequelae liver cirrhosis or hepatocellular carcinoma. Hepatitis B was recognized as a disease in ancient times, but its etiologic agent was only recently identified. The first clue in unraveling this mystery was the discovery of an enigmatic serum protein named Australia antigen 50 years ago by Baruch Blumberg. Some years later this was recognized to be the HBV surface antigen (HBsAg). Detection of HBsAg allowed for the first time screening of inapparently infected blood donors for a dangerous pathogen. The need to diagnose clinically silent HBV infections was a strong driving force in the development of modern virus diagnostics. HBsAg was the first infection marker to be assayed with a highly sensitive radio immune assay. HBV itself was among the first viruses to be detected by assay of its DNA genome and IgM antibodies against the HBV core antigen were the first to be selectively detected by the anti-μ capture assay. The cloning and sequencing of the HBV genome in 1978 paved the way to understand the viral life cycle, and allowed development of efficient vaccines and drugs. Today’s hepatitis B vaccine was the first vaccine produced by gene technology. Among the problems that still remain today are the inability to achieve a complete cure of chronic HBV infections, the recognition of occult HBV infections, their potential reactivation and the incomplete protection against escape mutants and heterologous HBV genotypes by HBV vaccines.

show abstract

Section: Vaccinationmentioning

confidence: 99%

Medical Virology of Hepatitis B: how it began and where we are now

Gerlich

2013

Virol J

277

229

View full text Add to dashboard Cite

show abstract

“…Generation of rSFV vector plasmids (pSFV1) encoding the 1-48preS/S variants with the myristic acid attachment site have been described [18]. Its variant with Gly 2 substituted to Ser (pSFV1-G2S 1-48preS/S) (Figure 1A) was generated by amplification of the corresponding gene from the plasmid pFD Pr[13–59]S (kindly provided by K. Sasnauskas) by forward primer 5 ′ GACACAGATCTGCCGCCACCATGTCTCAGAATCTTTCCAC 3 ′ ; the G2A variant (pSFV1-G2A 1-48preS/S) (Figure 1A) was generated by forward primer 5 ′ GACACAGATCTGCCGCCACCATGGCCCAGAATCTTTCCAC 3 ′ from plasmid pFD GlyPr[13–59] (gift from K. Sasnauskas).…”

Section: Resultsmentioning

confidence: 99%

“…Huh7 cells were infected with rSFV at MOI 10, cell medium was replaced after 18 h with a fresh medium, which was collected after 24 h and cells were lysed with 0.5% Triton X-100 lysis buffer. Cell medium and lysates were subjected to in-house ELISAs as described [18] with monoclonal antibodies (MAbs) MA18/7 recognizing epitope DPAF of preS1 20–23 in genotype D and C20/02 recognizing the correctly folded S domain between aa 118 and 149 (W. H. Gerlich, unpublished).…”

Section: Resultsmentioning

confidence: 99%

“…To rule out that these particles were released by cell lysis due to transduction with the apoptosis-inducing rSFV vector, Huh7 cells were transduced with rSFV encoding full length L protein expressing also S and M (not shown) and the secretion incompetent variant 1-48preS/S 0 which lacks the start codon of S protein [18]. In case of the 1-48preS/S 0 variant, the MA18/7-specific signal from the cell medium was barely above the cut-off (Table 1), while no MA18/7-specific signal was found in the cell medium of L protein transduced cells (not shown).…”

Section: Resultsmentioning

confidence: 99%

“…These observations led to the design of expression vectors encoding the N-terminal part of preS1 linked with the S protein for the generation of potential HBV vaccines [16,17]. Using replication-deficient Semliki Forest virus (rSFV) vectors, we could express the neutralization-relevant preS1 part linked to the S domain of HBs subviral particles and consequently use these vectors for immunization of mice [18]. The influence of the large internal deletion in the L protein on its structure and topology was not yet known.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Posttranslational modifications and secretion efficiency of immunogenic hepatitis B virus L protein deletion variants

Niedre-Otomere

Bogdanova

Brüvere

et al. 2013

Virol J

View full text Add to dashboard Cite

BackgroundSubviral particles of hepatitis B virus (HBV) composed of L protein deletion variants with the 48 N-terminal amino acids of preS joined to the N-terminus of S protein (1-48preS/S) induced broadly neutralizing antibodies after immunization of mice with a Semliki Forest virus vector. A practical limitation for use as vaccine is the suboptimal secretion of such particles. The role of the N-terminal preS myristoylation in the cellular retention of full-length L protein is described controversially in the literature and the relation of these data to the truncated L protein was unknown. Thus, we studied the effect of preS myristoylation signal suppression on 1-48preS/S secretion efficiency, glycosylation and subcellular distribution.FindingsThe findings are that 1-48preS/S is secreted, and that removal of the N-terminal myristoylation signal in its G2A variant reduced secretion slightly, but significantly. The glycosylation pattern of 1-48preS/S was not affected by the removal of the myristoylation signal (G2A mutant) but was different than natural L protein, whereby N4 of the preS and N3 of the S domain were ectopically glycosylated. This suggested cotranslational translocation of 1-48preS in contrast to natural L protein. The 1-48preS/S bearing a myristoylation signal was localized in a compact, perinuclear pattern with strong colocalization of preS and S epitopes, while the non-myristoylated mutants demonstrated a dispersed, granular cytoplasmic distribution with weaker colocalization.ConclusionsThe large deletion in 1-48preS/S in presence of the myristoylation site facilitated formation and secretion of protein particles with neutralizing preS1 epitopes at their surface and could be a useful feature for future hepatitis B vaccines.

show abstract

Prophylactic vaccination against hepatitis B: achievements, challenges and perspectives

Gerlich

2014

Med Microbiol Immunol

View full text Add to dashboard Cite

Large-scale vaccination against hepatitis B virus (HBV) infection started in 1984 with first-generation vaccines made from plasma of chronic carriers containing HBV surface antigen (HBsAg). Thereafter, it was replaced in most countries by second-generation vaccines manufactured in yeast cells transformed with gene S encoding HBsAg. Both generations of vaccines have been applied for universal neonate and early childhood vaccination worldwide and have led to a 70-90 % decrease in chronic HBV carrier rates. However, 10-30% of newborns from HBsAg/HBeAg-positive mothers cannot be protected by passive/active vaccination alone and become chronic HBV carriers themselves. Asymptomatic occult HBV infections are frequent even in those who have protective levels of anti-HBs. Suboptimal protection may be due to heterologous HBsAg subtypes that are present in 99% of HBV carriers worldwide. Second-generation vaccines contain partially misfolded HBsAg and lack preS1 antigen that carries the major HBV attachment site and neutralizing epitopes. Third-generation vaccines produced in mammalian cells contain correctly folded HBsAg and neutralizing epitopes of the preS antigens, induce more rapid protection, overcome nonresponse to second-generation vaccines and, most importantly, may provide better protection for newborns of HBV-positive mothers. PreS/S vaccines expressed in mammalian cells are more expensive to manufacture, but introduction of more potent HBV vaccines should be considered in regions with a high rate of vertical transmission pending assessment of health economics and healthcare priorities. With optimal vaccines and vaccination coverage, eradication of HBV would be possible.

show abstract

Recombinant Semliki Forest virus vectors encoding hepatitis B virus small surface and pre‐S1 antigens induce broadly reactive neutralizing antibodies

Cited by 8 publications

References 46 publications

Medical Virology of Hepatitis B: how it began and where we are now

Medical Virology of Hepatitis B: how it began and where we are now

Posttranslational modifications and secretion efficiency of immunogenic hepatitis B virus L protein deletion variants

Prophylactic vaccination against hepatitis B: achievements, challenges and perspectives

Contact Info

Product

Resources

About