Recognition of Proline‐Rich Motifs by Protein–Protein‐Interaction Domains

Abstract

Protein-protein interactions are essential in every aspect of cellular activity. Multiprotein complexes form and dissociate constantly in a specifically tuned manner, often by conserved mechanisms. Protein domains that bind proline-rich motifs (PRMs) are frequently involved in signaling events. The unique properties of proline provide a mechanism for highly discriminatory recognition without requiring high affinities. We present herein a detailed, quantitative assessment of the structural features that define the interfaces between PRM-binding domains and their target PRMs, and investigate the specificity of PRM recognition. Together with the analysis of peptide-library screens, this approach has allowed the identification of several highly conserved key interactions found in all complexes of PRM-binding domains. The inhibition of protein-protein interactions by using small-molecule agents is very challenging. Therefore, it is important to first pinpoint the critical interactions that must be considered in the design of inhibitors of PRM-binding domains.

Deciphering the Cross Talk between hnRNP K and c-Src: the c-Src Activation Domain in hnRNP K Is Distinct from a Second Interaction Site

“…The plasmid pET16b-hnRNP K has been described in reference 37. The proline-to-alanine substitution variants pET16b-hnRNP K or pSG5-His-hnRNP K P1, P2(1), P2(2), P2(3), P3(1), P3(2), and (P2 (2,3) P3 (1,2) ) were generated using a site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol. The plasmid pET16b-P 2-3 (Pro285-Gly318) was generated by PCR using forward (5ЈGGGAATTCCATATG CCTCGTCGAGGACCACCTCCC3Ј) and reverse (5ЈCGCGGATCCTTATCCCC CTCTAGGTGGTGGTGG3Ј) primers and inserted into NdeI/BamHI of pET16b (Novagen).…”

The solution structure of pGolemi, a high affinity Mena EVH1 binding miniature protein, suggests explanations for paralog-specific binding to Ena/VASP homology (EVH) 1 domains

“…The essential binding residues in the proline-rich repeats of ActA were identified as xFPPFPTxxEL (Niebuhr et al, 1997) matching perfectly the motif for class 1 EVH1 domains with a consensus sequence of (D/E)(F/L/W/Y)PxFPx 1-3 (Ball et al, 2005). The specificity residues to be discussed now were prudentially grafted onto aPP in order not to disturb the PPII geometry (Figure 3, shaded), which has been shown to be a prerequisite for substrate binding to EVH1 domains (Ball et al, 2005) and could be seen in all determined complex structures for EVH1 domains (Fedorov et al, 1999;Prehoda et al, 1999).…”

“…As can be seen by comparison with the polyproline binding site of Mena EVH1, the flexible, first two residues might pave the way for an interaction of F2 with its highly restricted binding site between N71 and R81 on Mena EVH1 as an initial contact (Prehoda et al, 1999). After a conformational change into the wedge-like PPII helix geometry, the more rigid part of the binding site of pGolemi could then easily interact with the conserved hydrophobic triad at the ligand binding site of EVH1 domains (Y16, W23, F77; Mena nomenclature, for review on EVH1domains see Ball et al, 2005). These domains, namely Mena, VASP and Evl, with high resolution structures available, share up to 70% sequence identity and have a very conserved peptide binding site (Gertler et al, 1996;Fedorov et al, 1999;Prehoda et al, 1999;Ball et al, 2000).…”

A Focal Adhesion Kinase-Derived Peptide Binds the Src SH3 Domain in Two Orientations, As Demonstrated Using Paramagnetic Nuclear Magnetic Resonance

“…Intramolecular PREs in the SH3 domain were determined by recording [ 1 H, 15 N] HSQC spectra. Intermolecular PREs between the Src SH3 domain and the peptide were obtained from [ 1 H, 13 C] constant time HSQC (CT-HSQC) NMR experiments to achieve the high spectral resolution and ensure reliable calculations of PREs. Relaxation delays of 1.5 s were used.…”

“…Two versions of the FAK peptide were synthesized, with 13 C-labeled Ala and Pro residues close to the N-terminus, RALPSIPKLA (peptide 1, labeled residues underlined), and the C-terminus, RALPSIPKLA (peptide 2). 13 C HSQC spectra were recorded for the free peptide and in the presence of the SH3 domain with a 5-fold molar excess of the peptide (Figure 4 and Figure S5). Nine resonances are expected in the 1 H dimension, two from Ala (Hα and Hβ) and seven from Pro (Hα, Hβ2 and -3, Hγ2 and -3, and Hδ2 and -3), as well as some weak natural abundance signals.…”