RecA-Dependent Recovery of Arrested DNA Replication Forks

Courcelle, Justin; Hanawalt, Philip C.

doi:10.1146/annurev.genet.37.110801.142616

Cited by 185 publications

(172 citation statements)

References 196 publications

(259 reference statements)

Supporting

Mentioning

167

Contrasting

Order By: Relevance

“…In model A (adapted with modifications from ref. 44), RecFOR and RecA bind to the lagging strand template and promote the invasion of the leading strand, which renders the lesion double stranded and thus accessible to nucleotide excision repair (NER). We propose that the displaced leading strand end is degraded by a 3Ј exonuclease (such as Exo I, Exo VII, or Exo X).…”

Section: Resultsmentioning

confidence: 99%

“…5A; adapted with modification from ref. 44). In an alternative model, because UV irradiation induces one-strand lesions that theoretically block only one DNA polymerase, it has been proposed that a lesion on the leading strand template does not preclude progression of the lagging strand polymerase, resulting in a gap on the leading strand (refs.…”

Section: Replication Fork Arrest By Dna Damagementioning

confidence: 99%

“…The observation that the priA mutant undergoes replication fork reversal led us to conclude that the types of replication inactivation that cause replication fork reversal, such as a (34) RecBC, RecA, and RuvABC Replication-dependent linear DNA Overreplication (Fig. 4) UV irradiation (38)(39)(40)(41)(42)(43)(44)(45)(46)(47)(48)(49)(50)(51)(52)(53) RecFOR and RecA Replication-dependent linear DNA Several models *In replication mutants or strains with ectopic Ter sites, because replication blockage is the only damage, the recombination proteins essential for viability are presumably essential for restart. In UV-irradiated cells, several types of damage occur, and all recombination proteins are required for full viability.…”

Section: Spontaneous Replication Fork Arrest: the Pria Mutantmentioning

confidence: 99%

See 2 more Smart Citations

Multiple pathways process stalled replication forks

Michel

Grompone

Flores

et al. 2004

Proc. Natl. Acad. Sci. U.S.A.

309

330

View full text Add to dashboard Cite

Impairment of replication fork progression is a serious threat to living organisms and a potential source of genome instability. Studies in prokaryotes have provided evidence that inactivated replication forks can restart by the reassembly of the replication machinery. Several strategies for the processing of inactivated replication forks before replisome reassembly have been described. Most of these require the action of recombination proteins, with different proteins being implicated, depending on the cause of fork arrest. The action of recombination proteins at blocked forks is not necessarily accompanied by a strand-exchange reaction and may prevent rather than repair fork breakage. These various restart pathways may reflect different structures at stalled forks. We review here the different strategies of fork processing elicited by different kinds of replication impairments in prokaryotes and the variety of roles played by recombination proteins in these processes.W ork from several laboratories has established that in bacteria, a recombination event can lead to the establishment of a unidirectional replication fork (reviewed in refs. 1-3). These observations extend the concept of a direct recombination-replication connection, originally proposed Ϸ30 years ago from studies of bacteriophage T4 and replication. Furthermore, the existence of recombination-dependent replication in yeast suggests that this connection may be a widely distributed phenomenon (4, 5).Considering the tight control of replication initiation at chromosomal origins, the assembly of a complete replisome at recombination intermediates, independently of time and place, is paradoxical. One of the raisons d'être of this potentially dangerous process was revealed by the finding that recombination intermediates form at inactivated replication forks and are used for replication restart. However, studies of the replicationrecombination connection in Escherichia coli have indicated that recombination proteins do not necessarily catalyze strand exchange at blocked forks and rather act in a variety of reactions that depend on the origin of the arrest. We review here the diversity of fates of inactivated replication forks in bacteria, as well as our present knowledge of the roles played by recombination proteins during replication restart. DNA Double-Strand End Repair in BacteriaAlmost 30 years ago, Higgins et al. (6) proposed that blocked replication forks could be isomerized into a four-way Holliday junction (HJ) with a DNA double-strand end, which could permit DNA repair and then continuation of replication (Fig. 1, step A). The test of the model, performed by treatment of mammalian cells with a DNA-damaging agent, was inconclusive (7). However, more recent studies in E. coli suggest that such replication fork reversal plays a crucial role in replication restart in bacteria (8,9).A key aspect of the replication fork reversal model is that it generates a DNA double-strand end at blocked forks without chromosome breakage. In E. coli, the enzyme th...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Replication Fork Arrest By Dna Damagementioning

confidence: 99%

Section: Spontaneous Replication Fork Arrest: the Pria Mutantmentioning

confidence: 99%

See 1 more Smart Citation

Multiple pathways process stalled replication forks

Michel

Grompone

Flores

et al. 2004

Proc. Natl. Acad. Sci. U.S.A.

309

330

View full text Add to dashboard Cite

show abstract

“…One of the major functions of RecA is the activation of translesion DNA synthesis polymerases and DNA-repair mechanisms (Courcelle & Hanawalt, 2003;Harfe & JinksRobertson, 2000). Therefore, we investigated these specific functions of RecA in L. monocytogenes.…”

Section: Discussionmentioning

confidence: 99%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

show abstract

“…However, the current consensus on the processing and restart of stalled replication forks (12,21,22) does not explain UV radiation-induced genetic instability, leaving our understanding of UV damage processing incomplete.…”

mentioning

confidence: 99%

Replication Forks Stalled at Ultraviolet Lesions Are Rescued via RecA and RuvABC Protein-catalyzed Disintegration in Escherichia coli

Khan

Kuzminov

2012

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background: Ultraviolet (UV) light causes genetic instability, suggesting chromosome fragmentation. Results: UV light induces chromosomal fragmentation, which is independent of excision of UV lesions but requires replication forks, homologous strand exchange, and Holliday junction resolution. Conclusion: Fragmentation is a result of replication fork reversal and breakage. Significance: Breakage is the first step in rescuing stalled replication forks.

show abstract

RecA-Dependent Recovery of Arrested DNA Replication Forks

Cited by 185 publications

References 196 publications

Multiple pathways process stalled replication forks

Multiple pathways process stalled replication forks

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Replication Forks Stalled at Ultraviolet Lesions Are Rescued via RecA and RuvABC Protein-catalyzed Disintegration in Escherichia coli

Contact Info

Product

Resources

About