Real-time PCR detection of Toxoplasma gondii in tissue samples of wild boars (Sus scrofa) from southern Italy reveals high prevalence and parasite load

Abstract

Background Toxoplasmosis is a zoonotic parasitic disease caused by Toxoplasma gondii , a widespread protozoan in the phylum Apicomplexa. In Europe, several studies have demonstrated the presence of the parasite in tissues of wild boars ( Sus scrofa ), but no data exists on the T. gondii load in tissues which in turn may be an useful way to assess the infection risk for the consumer of wild boar meat. Methods We sampled and tested a total of 472 tissue samples of brain, heart and masseter muscle from 177 wild boars from the Campania region of southern Italy by real-time PCR analyses for detection and quantification of T. gondii . The sensitivity and specificity of the method were calculated by ROC analysis curves. Results PCR analysis revealed the presence of T. gondii in tissue samples of 78 out of 177 (44%) wild boars. In general, the brain presented the highest PCR prevalence (31%), followed by the heart (28.3%) and the masseter muscle (24.2%), with the highest estimated parasite numbers observed in the brain followed by the heart and masseter muscle. The PCR method showed an excellent discriminating ability for each of the examined tissues. According to the ROC analysis curves, the respective sensitivity and specificity were 99 and 100% for masseter muscle, 98 and 98% for brain and 96 and 98% for heart samples. Conclusions The high prevalence of infection here detected suggests a widespread distribution of the parasite in the wildlife of the Campania region of southern Italy. The T. gondii burdens detected may potentially represent a source of infection for humans.

Genotyping of Toxoplasma gondii in wild boar (Sus scrofa) in southern Italy: Epidemiological survey and associated risk for consumers

“…In this study, although the cause of infection by T . gondii in wild boars was not investigated, it is highly unlikely that these ungulates contract the infection through the ingestion of sporulated oocysts defecated by cats, especially in the remote rural and wooded areas of southern Italy, where the wild boar were culled (Santoro et al., 2019). Conversely, wild boar may interact with a wide range of different prey (including birds, rodents and foxes) due to their scavenging behaviour.…”

“…Following Santoro et al. (2019), we sampled the masseter since it is the main muscle used in southern Italy to prepare traditional meat products (‘guanciale’ and sausages).…”

“…The real‐time PCR was used to detect the T. gondii B1 gene following Lin, Chen, Kuo, Tseng, and Tseng (2000), in a final reaction volume of 25 µl instead of 50 µl, as described by Santoro et al. (2019). Briefly, 5 μl of template DNA was added to a reaction mixture containing PCR universal master mix 1X, 0.5 μM of each primer (forward primer TOXO‐F, 5'‐TCCCCTCTGCTGGCGAAAAGT‐3' and reverse primer TOXO‐R, 5'‐AGCGTTCGTGGTCAACTATCGATTG‐3') and 0.2 µM of TaqMan probe (2 µM, 6FAM‐TCTGTGCAACTTTGGTGTATTCGCAG‐TAMRA).…”

Parasite Load and STRs Genotyping of Toxoplasma gondii Isolates From Mediterranean Mussels (Mytilus galloprovincialis) in Southern Italy

“…A standard curve was obtained by linear regression analysis of the threshold cycle (Ct) value (y axis) versus the log of the initial copy number present in each sample dilution (x axis). PCR efficiency (E) was calculated as E = 10 (1/slope)-1 (Lin et al, 2000;Peirson et al, 2003;Rutledge and Còté, 2003;Santoro et al, 2019b). The number of oocysts of T. gondii for each sample was estimated as suggested previously (Lass et al, 2012).…”

“…The real-time PCR (qPCR) for detection and quantification of T. gondii B1 gene was performed following a previous study (Lin et al, 2000), with modification of the final volume to 25 µl (Santoro et al, 2019b). In brief, 5 µl of template DNA was added to a reaction mixture containing 12.5 µl of 2X PCR universal master mix (Thermo Fischer Scientific, Waltham, MA, United States), 2.5 µl of the forward primer TOXO-F (5 µM, 5 -TCCCCTCTGCTGGCGAAAAGT-3 ) ( • C for 1 min were run.…”