Real-time PCR designs to estimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies

Alonso, Antonio; Martı́n, Pablo; Albarrán, Cristina; García, Pilar Peral; Garcı́a, Oscar; Simón, Lourdes Fernández de; Garcı́a-Hirschfeld, Julia; Sancho, Manuel; Rúa, Concepción de la; Fernández‐Piqueras, José

doi:10.1016/j.forsciint.2003.10.008

Cited by 167 publications

(127 citation statements)

References 17 publications

Supporting

Mentioning

121

Contrasting

Unclassified

Order By: Relevance

“…[10][11][12][13] DNA was extracted from 200 mL of unfractionated sample by using the Plasma-9 Serum Circulating DNA Purification Mini kit (catalog number 50600; Norgen Biotek, Thorold, Ontario, Canada) according to published methods. 7 DNA was eluted in 100-mL final volume and stored at 220°C.…”

Section: Real-time Polymerase Chain Reactionmentioning

confidence: 99%

Cow’s Milk Contamination of Human Milk Purchased via the Internet

et al. 2015

View full text Add to dashboard Cite

show abstract

Section: Real-time Polymerase Chain Reactionmentioning

confidence: 99%

Cow’s Milk Contamination of Human Milk Purchased via the Internet

et al. 2015

View full text Add to dashboard Cite

show abstract

“…13 We used iQ SYBR Green Supermix (BioRad) in a iCycler Thermal Cycler (BioRad). Primers and thermal cycling conditions were as previously specified.…”

Section: Real-time Pcr Quantificationmentioning

confidence: 99%

The maternal aborigine colonization of La Palma (Canary Islands)

et al. 2009

View full text Add to dashboard Cite

Teeth from 38 aboriginal remains of La Palma (Canary Islands) were analyzed for external and endogenous mitochondrial DNA control region sequences and for diagnostic coding positions. Informative sequences were obtained from 30 individuals (78.9%). The majority of lineages (93%) were from West Eurasian origin, being the rest (7%) from sub-Saharan African ascription. The bulk of the aboriginal haplotypes had exact matches in North Africa (70%). However, the indigenous Canarian sub-type U6b1, also detected in La Palma, has not yet been found in North Africa, the cradle of the U6 expansion. The most abundant H1 clade in La Palma, defined by transition 16260, is also very rare in North Africa. This means that the exact region from which the ancestors of the Canarian aborigines came has not yet been sampled or that they have been replaced by later human migrations. The high gene diversity found in La Palma (95.2±2.3), which is one of the farthest islands from the African continent, is of the same level than the previously found in the central island of Tenerife (92.4±2.8). This is against the supposition that the islands were colonized from the continent by island hopping and posterior isolation. On the other hand, the great similarity found between the aboriginal populations of La Palma and Tenerife is against the idea of an island-by-island independent maritime colonization without secondary contacts. Our data better fit to an island model with frequent migrations between islands.

show abstract

“…The primer sequences for the small fragment were: L16001 ACCATTAGCACCCAAAGCTAAGA and H16065 GCGGTTGTTGATGGGTGAGT, and for the larger one: L16088 TCACCCATCAACAACCGCTAT and H16344 GGGACGAGAAGGGATTTGACT. The probe oligonucleotide sequence for the small fragment was FAM-CAAGCAAGTACAGCAA-MGB and for the large was VIC-GAAGCAGATTTGGGTAC-MGB (Alonso et al 2004). Real-time PCR amplification was performed in a 20µl reaction with 1x reaction TaqMan Universal PCR Master Mix (Applied Biosystem), 0,5 µM each primer, 50nM probes, 1mg/ml BSA and 1 µl DNA extract.…”

Section: Quantitation Of Number Of Dna Template Moleculesmentioning

confidence: 99%

The Genetics of the Pre‐Roman Iberian Peninsula: A mtDNA Study of Ancient Iberians

Sampietro

Caramelli

Lao

et al. 2005

Annals of Human Genetics

View full text Add to dashboard Cite

SummaryThe Iberians developed a surprisingly sophisticated culture in the Mediterranean coast of the Iberian Peninsula from the 6th century BC until their conquest by the Romans in the 2nd century BC. They spoke and wrote a non-IndoEuropean language that still cannot be understood; their origins and relationships with other non-Indo-European peoples, like the Etruscans, are unclear, since their funerary practices were based on the cremation of bodies, and therefore anthropology has been unable to approach the study of this people. We have retrieved mitochondrial DNA (mtDNA) from a few of the scarce skeletal remains that have been preserved, some of them belonging to ritualistically executed individuals. The most stringent authentication criteria proposed for ancient DNA, such as independent replication, amino-acid analysis, quantitation of template molecules, multiple extractions and cloning of PCR products, have been followed to obtain reliable sequences from the mtDNA hypervariable region 1 (HVR1), as well as some haplogroup diagnostic SNPs. Phylogeographic analyses show that the haplogroup composition of the ancient Iberians was very similar to that found in modern Iberian Peninsula populations, suggesting a long-term genetic continuity since pre-Roman times. Nonetheless, there is less genetic diversity in the ancient Iberians than is found among modern populations, a fact that could reflect the small population size at the origin of the population sampled, and the heterogenic tribal structure of the Iberian society. Moreover, the Iberians were not especially closely related to the Etruscans, which points to considerable genetic heterogeneity in Pre-Roman Western Europe.

show abstract

Real-time PCR designs to estimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies

Cited by 167 publications

References 17 publications

Cow’s Milk Contamination of Human Milk Purchased via the Internet

Cow’s Milk Contamination of Human Milk Purchased via the Internet

The maternal aborigine colonization of La Palma (Canary Islands)

The Genetics of the Pre‐Roman Iberian Peninsula: A mtDNA Study of Ancient Iberians

Contact Info

Product

Resources

About