RB expression confers sensitivity to CDK4/6 inhibitor–mediated radiosensitization across breast cancer subtypes

Pesch, Andrea M.; Hirsh, Nicole; Michmerhuizen, Anna R.; Jungles, Kassidy M.; Wilder-Romans, Kari; Chandler, Benjamin C.; Liu, Meilan; Lerner, Lynn M.; Nino, Charles A.; Ward, Connor; Cobain, Erin F.; Lawrence, Theodore S.; Pierce, Lori J.; Rae, James M.; Speers, Corey

doi:10.1172/jci.insight.154402

Cited by 11 publications

(9 citation statements)

References 69 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…CRISPR cell lines were generated using the lentiCRISPRv2 plasmid (Addgene #98291) and the AR guide sequence (5’ CACCTCCAGCTTGATGCGAGCGTG 3’). As previously described [ 28 ], the lentiCRISPRv2 plasmid was digested with BsmB1 for 15 min at 55 degrees and gel-purified using the QIAquick Gel Extraction Kit (Qiagen #28706X4). Oligonucleotides were obtained from Integrated DNA Technologies and annealed at 95 degrees then cooled at 5 degrees/min.…”

Section: Methodsmentioning

confidence: 99%

Androgen and oestrogen receptor co-expression determines the efficacy of hormone receptor-mediated radiosensitisation in breast cancer

et al. 2022

Self Cite

View full text Add to dashboard Cite

Purpose Radiation therapy (RT) and hormone receptor (HR) inhibition are used for the treatment of HR-positive breast cancers; however, little is known about the interaction of the androgen receptor (AR) and estrogen receptor (ER) in response to RT in AR-positive, ER-positive (AR+/ER+) breast cancers. Here we assessed radiosensitisation of AR+/ER+ cell lines using pharmacologic or genetic inhibition/degradation of AR and/or ER. Methods Radiosensitisation was assessed with AR antagonists (enzalutamide, apalutamide, darolutamide, seviteronel, ARD-61), ER antagonists (tamoxifen, fulvestrant) or using knockout of AR. Results Treatment with AR antagonists or ER antagonists in combination with RT did not result in radiosensitisation changes (radiation enhancement ratios [rER]: 0.76–1.21). Fulvestrant treatment provided significant radiosensitisation of CAMA-1 and BT-474 cells (rER: 1.06–2.0) but not ZR-75-1 cells (rER: 0.9–1.11). Combining tamoxifen with enzalutamide did not alter radiosensitivity using a 1 h or 1-week pretreatment (rER: 0.95–1.14). Radiosensitivity was unchanged in AR knockout compared to Cas9 cells (rER: 1.07 ± 0.11), and no additional radiosensitisation was achieved with tamoxifen or fulvestrant compared to Cas9 cells (rER: 0.84–1.19). Conclusion While radiosensitising in AR + TNBC, AR inhibition does not modulate radiation sensitivity in AR+/ER+ breast cancer. The efficacy of ER antagonists in combination with RT may also be dependent on AR expression.

show abstract

Section: Methodsmentioning

confidence: 99%

Androgen and oestrogen receptor co-expression determines the efficacy of hormone receptor-mediated radiosensitisation in breast cancer

et al. 2022

Self Cite

View full text Add to dashboard Cite

show abstract

“…The first checkpoint prevents the cell from advancing past the G1 phase, which happens between the G1 and S (synthetic) phases [26]. The retinoblastoma (Rb) gene encodes a protein that has been demonstrated to be important for this [27]. When activated, this tumor suppressor protein (pRb) binds to E2F transcription factors, preventing them from participating in cell replication.…”

Section: G1 Phasementioning

confidence: 99%

“…The Rb pathway has been identified as a potential cancer treatment target. pRb, like many other cell cycle-regulating molecules, is phosphorylated to an inactive state by cyclin-dependent kinases (CDKs) [27]. This allows pRb to dissociate from the transcription factors mentioned above and exert its impact on the cell's transcription machinery.…”

Section: G1 Phasementioning

confidence: 99%

Cellular and molecular basis of therapeutic approaches to breast cancer

El‐Tanani

Khatib

Al-Najjar

et al. 2023

Cellular Signalling

View full text Add to dashboard Cite

“…We and others have shown that RT and CDK4/6 inhibitors can be safely combined and mediate additive-to-synergistic therapeutic effects in a variety of tumor models, including cultured human and mouse cancer cells, as well as human tumors xenografted in immunodeficient mice and mouse tumors evolving in immunocompetent syngeneic hosts [ 24 – 31 ]. Importantly, some of these studies revealed the relevance of treatment schedule on therapeutic efficacy [ 24 – 26 , 32 ].…”

Section: Introductionmentioning

confidence: 99%

Cellular senescence in the response of HR+ breast cancer to radiotherapy and CDK4/6 inhibitors

Klapp¹,

Buqué²,

Bloy³

et al. 2023

J Transl Med

View full text Add to dashboard Cite

Background Preclinical evidence from us and others demonstrates that the anticancer effects of cyclin-dependent kinase 4/6 (CDK4/6) inhibitors can be enhanced with focal radiation therapy (RT), but only when RT is delivered prior to (rather than after) CDK4/6 inhibition. Depending on tumor model, cellular senescence (an irreversible proliferative arrest that is associated with the secretion of numerous bioactive factors) has been attributed beneficial or detrimental effects on response to treatment. As both RT and CDK4/6 inhibitors elicit cellular senescence, we hypothesized that a differential accumulation of senescent cells in the tumor microenvironment could explain such an observation, i.e., the inferiority of CDK4/6 inhibition with palbociclib (P) followed by RT (P→RT) as compared to RT followed by palbociclib (RT→P). Methods The impact of cellular senescence on the interaction between RT and P was assessed by harnessing female INK-ATTAC mice, which express a dimerizable form of caspase 8 (CASP8) under the promoter of cyclin dependent kinase inhibitor 2A (Cdkn2a, coding for p16Ink4), as host for endogenous mammary tumors induced by the subcutaneous implantation of medroxyprogesterone acetate (MPA, M) pellets combined with the subsequent oral administration of 7,12-dimethylbenz[a]anthracene (DMBA, D). This endogenous mouse model of HR+ mammary carcinogenesis recapitulates key immunobiological aspects of human HR+ breast cancer. Mice bearing M/D-driven tumors were allocated to RT, P or their combination in the optional presence of the CASP8 dimerizer AP20187, and monitored for tumor growth, progression-free survival and overall survival. In parallel, induction of senescence in vitro, in cultured human mammary hormone receptor (HR)+ adenocarcinoma MCF7 cells, triple negative breast carcinoma MDA-MB-231 cells and mouse HR+ mammary carcinoma TS/A cells treated with RT, P or their combination, was determined by colorimetric assessment of senescence-associated β-galactosidase activity after 3 or 7 days of treatment. Results In vivo depletion of p16Ink4-expressing (senescent) cells ameliorated the efficacy of P→RT (but not that of RT→P) in the M/D-driven model of HR+ mammary carcinogenesis. Accordingly, P→RT induced higher levels of cellular senescence than R→TP in cultured human and mouse breast cancer cell lines. Conclusions Pending validation in other experimental systems, these findings suggest that a program of cellular senescence in malignant cells may explain (at least partially) the inferiority of P→RT versus RT→P in preclinical models of HR+ breast cancer.

show abstract

RB expression confers sensitivity to CDK4/6 inhibitor–mediated radiosensitization across breast cancer subtypes

Cited by 11 publications

References 69 publications

Androgen and oestrogen receptor co-expression determines the efficacy of hormone receptor-mediated radiosensitisation in breast cancer

Androgen and oestrogen receptor co-expression determines the efficacy of hormone receptor-mediated radiosensitisation in breast cancer

Cellular and molecular basis of therapeutic approaches to breast cancer

Cellular senescence in the response of HR+ breast cancer to radiotherapy and CDK4/6 inhibitors

Contact Info

Product

Resources

About