Rational Crystal Contact Engineering of Lactobacillus brevis Alcohol Dehydrogenase To Promote Technical Protein Crystallization

Abstract

Technical protein crystallization is an alternative to preparative chromatography for purification of proteins. However, only a few proteins are satisfactorily crystallizable for this technical purpose. In the present work, the crystallizability of Lactobacillus brevis alcohol dehydrogenase (LbADH) was significantly improved by rational engineering of its crystal contact patches. The concept was to exchange amino acids at the crystal contact patches with the objective of (i) surface entropy reduction (SER) and (ii) enhancement of ionic interactions. We present three newly designed, enzymatically active LbADH mutants with improved crystallizability: K32A (via SER) and Q126H and Q126K (both via enhancement of ionic interactions). The wild type crystallized with a low crystallization success rate in microbatch experiments. All mutants crystallized consistently with enhanced crystallization kinetics under identical conditions. Mutant K32A crystallized at reduced protein concentrations. Mutant Q126H crystallized at reduced concentrations of protein and the crystallization agent polyethylene glycol. Furthermore, the X-ray structure of mutant K32A reveals evidence of crystal contact enforcement which does explain enhanced crystallizability on the atomic level. The increased space–time yield of mutant K32A in stirred tank crystallizers demonstrates that rational crystal contact engineering is a powerful tool to promote technical protein crystallization.

Crystal Contact Engineering Enables Efficient Capture and Purification of an Oxidoreductase by Technical Crystallization

“…K32A and Q126H were the two best crystallizing Lb ADH mutants, which we identified in a previous study. [ 16 ] The amino acid exchange T102E was intended to generate a salt bridge (ionic interaction) between glutamic acid (E) and a facing lysine (K). Contrary to results presented in Nowotny et al., [ 16 ] mutant T102E crystallized significantly better than the WT, applying a high variety of crystallization conditions, ranging from 0 to 5 g L −1 protein and 0 to 100 g L −1 polyethylene glycol monomethyl ether (PEG 550 MME).…”

“…Site-Directed Mutagenesis: The genetic basis of all mutageneses was the gene of His 6 -tagged wildtype (WT) LbADH encoded on DNA plasmid pet28a(+) as described in Hermann et al [24] Site-directed mutagenesis was performed applying the standard QuikChange (QC)-PCR protocol with adaptions in primer design according to Zheng et al [25] Primers used for mutant LbADH T102E were GAAACCGAGACTGCTGAATGGC (forward) and GCAGTCTCGGTTTCTTCGACAC (reverse), for D54F CACTC-CTTTCCAGATTCAATTTTTCC (forward) and GAATCTGGAAAGGAGTGC-CGACAC (reverse), and for D54Y CACTCCTTATCAGATTCAATT TTTCC (forward) and GAATCTGATAAGGAGTGCCGACAC (reverse). Primers for LbADH K32A, Q126H, and Q126K were previously published in Nowotny et al [16] All double mutations were introduced by two respective consecutive QC-PCR runs. After DpnI digestion, E. coli DH5 transformation, and plasmid DNA extraction, plasmid DNA sequencing verified correct DNA mutations.…”

“…Production and Further Processing of LbADH Variants: Recombinant production with E. coli BL21 (DE3) of all LbADH variants, dialysis, and purification via immobilized metal affinity chromatography for experiments on the µL-scale were conducted as described in Nowotny et al [16] For the first part of the stirred mL-scale experiments using dialyzed cell lysate, cell disruption was performed in 10 mL PBS, pH 7.4 (25-30 g L −1 cell dry weight) by sonication (3 × 3 min, 90% intensity, 50% pulse, Sonoplus HD 2070 and Micro tip MS 72, BANDELIN electronic, GmbH & Co. KG, Berlin, Germany) prior to dialysis against protein buffer (20 mm HEPES-NaOH pH 7.0, 1 mm MgCl 2 ). For the second part of the stirred mL-scale experiments using clarified cell lysate, cell disruption was directly conducted in 10 mL protein buffer under identical conditions.…”

“…Crystallization of LbADH Variants: The batch crystallization of purified LbADH variants on the µL-scale was conducted as described in Nowotny et al, [16] but with an increased number of crystallization conditions. The crystallization buffer was composed of 100 mm Tris-HCl at pH 7.0, 50 mm MgCl 2 , and varying concentrations of PEG 550 MME between 0 and 200 g L −1 .…”

“…Previously, we demonstrated a proof of concept which addresses this hitherto empirical and elaborate screening step by rationally redesigning the protein itself instead of changing the crystallization conditions. [ 16 ] We showed that both surface entropy reduction (SER), a protein engineering strategy developed for crystallographic purpose, [ 17 ] and the introduction of charged amino acids at the crystal contact of Lactobacillus brevis alcohol dehydrogenase ( Lb ADH) can significantly enhance crystallizability of the purified protein. The term “enhanced crystallizability” was used to compare the crystallization behavior on the µL‐scale and represents the correlating observations of a higher number of crystals (equivalent to a higher nucleation rate), lower induction time, lower time span until crystallization equilibrium, and crystallization at reduced concentrations of protein and crystallization agent.…”