Rapid, whole blood diagnostic test for detecting anti-hantavirus antibody in rats

Amada, Takako; Yoshimatsu, Kumiko; Yasuda, Shumpei P.; Shimizu, Kenta; Koma, Takaaki; Hayashimoto, Nobuhito; Gamage, Chandika D.; Nishio, Sanae; Takakura, Akira; Arikawa, Jiro

doi:10.1016/j.jviromet.2013.04.021

Cited by 26 publications

(24 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Early in infection, large amounts of N protein are expressed [Vapalahti et al, ]. The immune response in Hantavirus patients is directed mainly against N protein logically diagnostic tests should be best designed to detect this response [Amada et al, ; Yoshimastu and Arikawa, 2014]. Also, the peptide should be at least of 20 mers to be amenable for the development of specific Enzyme Immunoassays (EIA) based immunodiagnostic tools.…”

mentioning

confidence: 99%

Prediction of B Cell Epitopes Among Hantavirus Strains Causing Hemorragic Fever With Renal Syndrome

Sagadevan

Sankar

Ramamurthy

et al. 2016

J of Cellular Biochemistry

View full text Add to dashboard Cite

Hantavirus infections are now recognized to be a global problem. The hantaviruses include several genotypic variants of the virus with different distributions in varying geographical regions. The virus genotypes seem to segregate in association with certain manifestations specific for each syndrome. They primarily include HFRS, HCPS, febrile illness with or without mild involvement of renal diseases. In the course of our study on hantavirus etiology of febrile illnesses, we recovered a hantavirus strain identified by nPCR. This has been sequenced to be Hantaan-like virus (partial S segment). The current manuscript is focused on understanding the N protein coded by S segment in terms of variation of amino acid sequences of the virus genotypes associated with HFRS. The diagnosis of this infection is achieved by PCR testing of serum/plasma or demonstration of IgM/IgG in serum. The limitations of PCR are temporal often not positive after 7 days of onset of infection. IgM detection is possible around this period and up to 21 days. IgG detection is less definitive in acute infections. Here, we report characterization of the sequence diversity of HFRS strains, 3D structure of Hantaan N protein, and B-cell epitopes on this molecule. We predicted a 20 amino acid sequence length peptide by using BepiPred online server in IEDB analysis resource program. We suggest this peptide may be used for development of geographic region-specific immunoassays like EIAs for antibody detection, monoclonal antibody development, and immunoblots (line immunoassay). J. Cell. Biochem. 118: 1182-1188, 2017. © 2016 Wiley Periodicals, Inc.

show abstract

mentioning

confidence: 99%

Prediction of B Cell Epitopes Among Hantavirus Strains Causing Hemorragic Fever With Renal Syndrome

Sagadevan

Sankar

Ramamurthy

et al. 2016

J of Cellular Biochemistry

View full text Add to dashboard Cite

show abstract

“…For this purpose, the multiplex three-line strip ICG test is considered to be the most useful for a rapid and safe serological test as it covers all antigenic groups of human pathogenic hantaviruses. Furthermore, the ICG test was applicable to diluted whole blood instead of serum specimens [16]. This allows the use of the ICG test in field surveillance or in resource-limited settings where adequate laboratory equipment is not available.…”

Section: Discussionmentioning

confidence: 99%

“…HS103 and PUU103 were expressed as an NUS and 6 X histidine -tagged recombinant protein using the pET43.1 plasmid vector (Novagen, Madison, WI, USA) and E. coli host strain BL21 (Novagen pET System Manual 10th ed.) as described previously [16,23]. The coding region of AND103 was amplified using primers ANDVSATG-speI (5′-aaa actagt atgagcaacctccaagaa-3′) and ANDVS103stop-xho1 (5′ - aat ctcgag ttaatccaggacatttccata -3′) by a previously described procedure [12].…”

Section: Methodsmentioning

confidence: 99%

Development of an immunochromatography strip test based on truncated nucleocapsid antigens of three representative hantaviruses

Amada

Yoshimatsu

Koma

et al. 2014

Virol J

Self Cite

View full text Add to dashboard Cite

BackgroundHantaviruses are causative agents of hemorrhagic fever with renal syndrome (HFRS) and nephropathia epidemica (NE) in the Old World and hantavirus pulmonary syndrome (HPS) in the New World. There is a need for time-saving diagnostic methods. In the present study, recombinant N antigens were used as antigens in an immunochromatography strip (ICG) test to detect specific IgG antibodies.MethodsThe N-terminal 103 amino acids (aa) of Hantaan virus (HTNV), Puumala virus (PUUV) and Andes virus (ANDV) nucleocapsid (N) protein were expressed in E. coli as representative antigens of three groups (HFRS, NE and HPS-causing viruses) of hantavirus. Five different types of ICG test strips, one antigen line on one strip for each of the three selected hantaviruses (HTNV, PUUV and ANDV), three antigen lines on one strip and a mixed antigen line on one strip, were developed and sensitivities were compared.ResultsA total of 87 convalescent-phase patient sera, including sera from 35 HFRS patients, 36 NE patients and 16 HPS patients, and 25 sera from healthy seronegative people as negative controls were used to evaluate the ICG test. Sensitivities of the three-line strip and mixed-line strip were similar to those of the single antigen strip (97.2 to 100%). On the other hand, all of the ICG test strips showed high specificities to healthy donors.ConclusionThese results indicated that the ICG test with the three representative antigens is an effective serodiagnostic tool for screening and typing of hantavirus infection in humans.

show abstract

“…Also, it has been demonstrated that early immune response in Hantavirus patients is directed mainly against N protein. Therefore, many virus diagnostics developed are based on detecting Hantavirus N protein or anti-N protein antibody ( Amada et al, 2013 ; Yoshimatsu and Arikawa, 2014 ).…”

Section: Structure and Properties Of The Hantavirus N Proteinmentioning

confidence: 99%

Hantaviral Proteins: Structure, Functions, and Role in Hantavirus Infection

et al. 2015

View full text Add to dashboard Cite

Hantaviruses are the members of the family Bunyaviridae that are naturally maintained in the populations of small mammals, mostly rodents. Most of these viruses can easily infect humans through contact with aerosols or dust generated by contaminated animal waste products. Depending on the particular Hantavirus involved, human infection could result in either hemorrhagic fever with renal syndrome or in Hantavirus cardiopulmonary syndrome. In the past few years, clinical cases of the Hantavirus caused diseases have been on the rise. Understanding structure of the Hantavirus genome and the functions of the key viral proteins are critical for the therapeutic agents’ research. This paper gives a brief overview of the current knowledge on the structure and properties of the Hantavirus nucleoprotein and the glycoproteins.

show abstract

Rapid, whole blood diagnostic test for detecting anti-hantavirus antibody in rats

Cited by 26 publications

References 37 publications

Prediction of B Cell Epitopes Among Hantavirus Strains Causing Hemorragic Fever With Renal Syndrome

Prediction of B Cell Epitopes Among Hantavirus Strains Causing Hemorragic Fever With Renal Syndrome

Development of an immunochromatography strip test based on truncated nucleocapsid antigens of three representative hantaviruses

Hantaviral Proteins: Structure, Functions, and Role in Hantavirus Infection

Contact Info

Product

Resources

About