Rapid quantitation of proinflammatory and chemoattractant cytokine expression in small tissue samples and monocyte-derived dendritic cells: validation of a new real-time RT-PCR technology

Blaschke, Volker; Reich, Kristian; Blaschke, Sabine; Zipprich, Sabine; Neumann, Christine

doi:10.1016/s0022-1759(00)00304-5

Cited by 80 publications

(51 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A Gaussian pattern of TLR-3 and TLR-7 gene modulation, with elevated expression at 24 hpi and decreased expression at 48 hpi, was observed specifically. A similar gene expression pattern was verified for IL-6 [55] during mdDC maturation, with high levels of modulation noted at the median time-point. Accordingly, sensing of viral RNA by TLR-3 and TLR-7 can modulate cell susceptibility to DV by inducing the secretion of type I IFN [51,52].…”

Section: Discussionsupporting

confidence: 67%

Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response

Silveira

Strottmann

Borba

et al. 2015

Clinical and Experimental Immunology

View full text Add to dashboard Cite

SummaryDengue is the most prevalent arboviral disease worldwide. The outcome of the infection is determined by the interplay of viral and host factors. In the present study, we evaluated the cellular response of human monocytederived DCs (mdDCs) infected with recombinant dengue virus type 1 (DV1) strains carrying a single point mutation in the NS3 hel protein (L435S or L480S). Both mutated viruses infect and replicate more efficiently and produce more viral progeny in infected mdDCs compared with the parental, non-mutated virus (vBACDV1). Additionally, global gene expression analysis using cDNA microarrays revealed that the mutated DVs induce the up-regulation of the interferon (IFN) signalling and pattern recognition receptor (PRR) canonical pathways in mdDCs. Pronounced production of type I IFN were detected specifically in mdDCs infected with DV1-NS3 helmutated virus compared with mdDCs infected with the parental virus. In addition, we showed that the type I IFN produced by mdDCs is able to reduce DV1 infection rates, suggesting that cytokine function is effective but not sufficient to mediate viral clearance of DV1-NS3 hel -mutated strains. Our results demonstrate that single point mutations in subdomain 2 have important implications for adenosine triphosphatase (ATPase) activity of DV1-NS3 hel . Although a direct functional connection between the increased ATPase activity and viral replication still requires further studies, these mutations speed up viral RNA replication and are sufficient to enhance viral replicative capacity in human primary cell infection and circumvent type I IFN activity. This information may have particular relevance for attenuated vaccine protocols designed for DV.

show abstract

Section: Discussionsupporting

confidence: 67%

Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response

Silveira

Strottmann

Borba

et al. 2015

Clinical and Experimental Immunology

View full text Add to dashboard Cite

show abstract

“…To determine absolute mRNA copy numbers, standard curves were generated for FLIP, caspase 8, and GAPDH using 10-fold dilution series of gel-purified PCR products (30). Two microliters of either external standards (ranging from 6 ϫ 10 6 to 6 ϫ 10 1 copies) or diluted cDNA samples (corresponding to 4 ng of total RNA per sample) was amplified in separate tubes for each target gene.…”

Section: Methodsmentioning

confidence: 99%

Inhibition of CD95 apoptotic signaling by interferon‐γ in human osteoarthritic chondrocytes is associated with increased expression of FLICE inhibitory protein

Grassi¹,

Piacentini²,

Cristino³

et al. 2004

Arthritis & Rheumatism

View full text Add to dashboard Cite

Objective. Cartilage homeostasis dysregulation during osteoarthritis (OA) has been linked to an increased rate of apoptosis of chondrocytes, the only cell type resident in the cartilage. In addition, the CD95-CD95 ligand (the Fas system) has emerged as one of the major pathways of cell death in the cartilage. We undertook the present study to investigate the role of interferon-␥ (IFN␥) in the regulation of the Fas system by analyzing the modulation of intracellular signaling molecules (FLICE inhibitory protein [FLIP] and caspases 3 and 8) in primary cultures of human OA chondrocytes.Methods. CD95-induced apoptotic death of human OA chondrocytes was analyzed in the presence or absence of IFN␥ using cell death immunoassay for apoptosis, real-time polymerase chain reaction for FLIP and caspase 8 expression, Western blotting for FLIP, and proteolytic activity for caspases 3 and 8.Results. CD95-induced apoptotic death of human OA chondrocytes was strongly counteracted by IFN␥ treatment, although the surface expression of CD95 was slightly up-regulated by this cytokine. The messenger RNA (mRNA) expression of FLIP and caspase 8, mediators involved in CD95 signaling, revealed that FLIP expression in human OA chondrocytes was significantly up-regulated (2-fold increase) by IFN␥ treatment. Moreover, the FLIP:caspase 8 mRNA ratio increased significantly. FLIP up-regulation by IFN␥ was confirmed at the protein level. Caspase 8 and caspase 3 proteolytic activities, both induced in these cells by stimulation with anti-CD95, were also significantly down-modulated by IFN␥.Conclusion. These findings suggest that IFN␥ impairs CD95-mediated signaling and apoptotic death in human chondrocytes. Its mechanism of action involves down-regulation of caspase 8 and caspase 3 activities and increased expression of the antiapoptotic protein FLIP, suggesting an interesting mechanism for the inhibition of chondrocyte apoptosis.Cartilage homeostasis dysregulation is a main feature of the osteoarthritic (OA) joint. Following repetitive mechanical stress as well as altered genetic factors, cartilage undergoes profound structural lesions mainly due to an increased synthesis of catabolic cytokines and matrix-degrading proteases (1,2). Chondrocytes, the only cell type present in the cartilage, play an essential regulatory function in matrix turnover. However, the rate of cellular turnover is affected during OA progression. Evidence is accumulating that chondrocyte response to mechanical and biochemical insults includes an increased rate of apoptosis (3-5), thus resulting in decreased tissue cellularity of the OA cartilage (6,7), an increased number of empty lacunae, and abnormal calcification of the subchondral bone (5,8). The hypothesis of a pathogenetic role of chondrocyte apoptosis in OA is supported by studies showing in situ a higher level of apoptosis in the OA cartilage compared with normal tissue (4,5) and a linkage between the rate of chondrocyte apoptosis and the severity of cartilage Supported by MURST (60% fund), Ricerca Corrente IOR, a...

show abstract

“…The primers for human actin were used in a previous paper 35 (hActin-forward: CCC GGCCAACCGCGAGAAGAT; hActin-reverse: GTCCCGGCCAGCCAGGTCCAG; product size 219 bp).…”

Section: Dna and Odnsmentioning

confidence: 99%

The toll-like receptor repertoire of human B lymphocytes: inducible and selective expression of TLR9 and TLR10 in normal and transformed cells

Bourke

Bosisio

Golay

et al. 2003

Blood

345

273

View full text Add to dashboard Cite

show abstract

Rapid quantitation of proinflammatory and chemoattractant cytokine expression in small tissue samples and monocyte-derived dendritic cells: validation of a new real-time RT-PCR technology

Cited by 80 publications

References 24 publications

Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response

Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response

Inhibition of CD95 apoptotic signaling by interferon‐γ in human osteoarthritic chondrocytes is associated with increased expression of FLICE inhibitory protein

The toll-like receptor repertoire of human B lymphocytes: inducible and selective expression of TLR9 and TLR10 in normal and transformed cells

Contact Info

Product

Resources

About