Rapid and Accurate Identification of Mycobacteria by Sequencing Hypervariable Regions of the 16S Ribosomal RNA Gene

Han, Xiang-Yang; Pham, Audrey S.; Tarrand, Jeffrey J.; Sood, Pramila K.; Luthra, Rajyalakshmi

doi:10.1309/hn44-xqym-jmaq-2edl

Cited by 102 publications

(69 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Further species identification of MAIC was achieved through sequencing analysis of the 16S rRNA gene as described previously (8). In the 665-bp sequenced region, M. avium and M. intracellulare differ by six nucleotides, which well differentiate these two species.…”

Section: Methodsmentioning

confidence: 99%

Clinical Significance and Epidemiologic Analyses of Mycobacterium avium and Mycobacterium intracellulare among Patients without AIDS

Han¹,

Tarrand²,

Infante

et al. 2005

J Clin Microbiol

Self Cite

View full text Add to dashboard Cite

The clinical significance and prevalence of Mycobacterium avium and Mycobacterium intracellulare were analyzed in a cohort of 7,472 patients who, from 1999 to 2003, sought care at the University of Texas M.D. Anderson Cancer Center, Houston, and had cultures performed for mycobacteria. Patients were stratified for age, sex, and underlying diseases, and bacteria were identified by 16S rRNA gene sequencing. M. avium was isolated in 62 (0.83%) of 7,472 patients and M. intracellulare in 65 (0.87%). Clinically, only 10 of the 62 (16.2%) patients with M. avium had probable to definite evidence of infection, whereas the majority (83.8%) had weak evidence of infection. Sex and age did not affect the isolation or infection of M. avium. Hematological tumors predisposed to M. avium colonization but not infection. In contrast, 41 of the 65 (63.1%) patients with M. intracellulare had probable to definite infection, a level much higher than those with M. avium (P < 0.001). M. intracellulare was more prevalent in women (1.33% of 3,311) than in men (0.50% of 4,161) (P < 0.001), and underlying diseases had no effect in women. Men with lung cancer had a higher prevalence (1.37%) than men without (0.34%) (4.0-fold; P < 0.001), but it was similar to that in women. A marked age trend for the isolation of M. intracellulare among women was noted: 0.27% (1-fold) for ages of <50 years, 0.85% (3.1-fold) for ages 50 to 59 years, 1.50% (5.6-fold) for ages 60 to 69 years, and 3.74% (13.9-fold) for ages >70 years (trend, P < 0.001). The combined rate for women >50 was 1.86% (95% confidence interval [1.30 to 2.42%]) (6.9-fold). Together, these results suggest that, among non-AIDS patients, M. intracellulare is more pathogenic and tends to infect women increasingly beyond menopause (age >50 years) regardless of underlying disease. The prevalence rate of 1.86% in postmenopausal women suggests the need to further investigate the public health significance of M. intracellulare.Mycobacterium avium and Mycobacterium intracellulare are slow-growing, nontuberculous mycobacterial (NTM) species that, due to similar biochemical characteristics, are usually grouped in the Mycobacterium avium-M. intracellulare complex (MAIC). The organisms are probably the most significant NTM associated with human diseases, causing disseminated infection in patients with AIDS, nodular bronchiectasis and other pulmonary infections, lymphadenitis, and skin infection (10).Although infrequently differentiated in the literature, M. avium and M. intracellulare exhibit significantly different pathogenicity and biology, as suggested by the following. First, the vast majority (Ͼ95%) of AIDS-related MAIC infections are due to M. avium, not M. intracellulare, and the M. avium infection typically occurs when the CD4 cell count falls to less than 0.05 ϫ 10 9 /liter (7, 10). Thus, deficiency in cellular immunity is an infection risk for M. avium but not for M. intracellulare. From a microbiology standpoint, the term MAIC in AIDS is obsolete (9). Second, nodular bronchiectasis caused b...

show abstract

Section: Methodsmentioning

confidence: 99%

Clinical Significance and Epidemiologic Analyses of Mycobacterium avium and Mycobacterium intracellulare among Patients without AIDS

Han¹,

Tarrand²,

Infante

et al. 2005

J Clin Microbiol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Sequencing of the 16S rDNA and phylogenetic analysis. The amplification of 16S ribosomal DNA (rDNA) by PCR and subsequent sequencing of the amplicon were performed as described previously (7). Briefly, extracted genomic DNA was amplified by a set of highly conserved (universal) bacterial primers: 5Ј TGCCAGCAGCCGCGGTAATAC 3Ј and 5Ј CGCTCGTTGCGGGACTT AACC 3Ј (positions 515 to 1,107 of Escherichia coli J01859).…”

Section: Methodsmentioning

confidence: 99%

Endocarditis with Ruptured Cerebral Aneurysm Caused by Cardiobacterium valvarum sp. nov

et al. 2004

Self Cite

View full text Add to dashboard Cite

A fastidious gram-negative bacterium was isolated from the blood of a 37-year-old man who had insidious endocarditis with a sudden rupture of a cerebral aneurysm. Characterization of the organism through phylogenetic and phenotypic analyses revealed a novel species of Cardiobacterium, for which the name Cardiobacterium valvarum sp. nov. is proposed. C. valvarum will supplement the current sole species Cardiobacterium hominis, a known cause of endocarditis. Surgeries and antibiotic treatment cured the patient's infection and associated complications. During cardiac surgery, a congenital bicuspid aortic valve was found to be the predisposing factor for his endocarditis.

show abstract

“…Positive cultures were initially identified via acid-fast stains (Kinyoun method). Further identification of various mycobacterial species was achieved through the sequencing analysis of the 16S rRNA gene upon PCR amplification as previously described (36). This method resolved 600 bp of the gene, which identified M. avium confidently by separating it from all other mycobacteria, particularly M. intracellulare, in which the two species differed by seven nucleotides in the amplicon (36).…”

Section: Methodsmentioning

confidence: 99%

Subspecies Identification and Significance of 257 Clinical Strains of Mycobacterium avium

Tran

Han

2014

J Clin Microbiol

Self Cite

View full text Add to dashboard Cite

Mycobacterium avium is abundant in the environment. It has four subspecies of three types: the human or porcine type, M. avium subsp. hominissuis; the bird type, including M. avium subsp. avium serotype 1 and serotype 2, 3 (also M. avium subsp. silvaticum); and the ruminant type, M. avium subsp. paratuberculosis. We determined the subspecies of 257 M. avium strains isolated from patients at the M.D. Anderson Cancer Center from 2001 to 2010 and assessed their clinical significance. An assay of multiplex PCR was used for the typing. Results showed M. avium subsp. hominissuis to be most common (n ‫؍‬ 238, 92.6%), followed by M. avium subsp. avium serotype 1 (n ‫؍‬ 12, 4.7%) and serotype 2, 3 (n ‫؍‬ 7, 2.7%). No strains of M. avium subsp. paratuberculosis were found. Of the 238 patients with M. avium subsp. hominissuis, 65 (27.3%) showed evidence of definite or probable infections, mostly in the respiratory tract, whereas the rest had weak evidence of infection. The bird-type subspecies, despite being infrequently isolated, caused relatively more definite and probable infections (10 of 19 strains, 52.6%). Overall, women of 50 years of age or older were more prone to M. avium infection than younger women or men of all ages were. We therefore conclude that M. avium subsp. hominissuis is the dominant M. avium subspecies clinically, that the two bird-type subspecies do cause human infections, and that M. avium infects mainly postmenopausal women. The lack of human clinical isolation of the ruminant type subspecies may need further investigation. N ontuberculous mycobacteria are ubiquitous in the environment and can cause significant disease in animals and humans (1-5). Mycobacterium avium and Mycobacterium intracellulare were the two original main species belonging to the M. avium-M. intracellulare complex (MAIC). M. avium is an important opportunistic pathogen that causes respiratory tract, lymph node, and, occasionally, soft tissue infections in healthy immunocompetent individuals (6, 7). Moreover, secondary infections with M. avium have gained increased attention over the decades due to the longevity of the immunocompromised population, i.e., individuals living with HIV and AIDS, and the administration of immunosuppressive chemotherapeutics in cancer patients (8).With the development of new molecular identification methods, M. avium has been further subdivided into four major subspecies: M. avium subsp. avium, M. avium subsp. paratuberculosis, M. avium subsp. silvaticum, and M. avium subsp. hominissuis (9, 10), each with distinct pathogenic characteristics and host preference and all considered possible zoonoses. These M. avium subspecies are considered to be a broad group, particularly M. avium subsp. avium and M. avium subsp. paratuberculosis as independently evolved pathogenic clones (9, 10).

show abstract

Rapid and Accurate Identification of Mycobacteria by Sequencing Hypervariable Regions of the 16S Ribosomal RNA Gene

Cited by 102 publications

References 15 publications

Clinical Significance and Epidemiologic Analyses of Mycobacterium avium and Mycobacterium intracellulare among Patients without AIDS

Clinical Significance and Epidemiologic Analyses of Mycobacterium avium and Mycobacterium intracellulare among Patients without AIDS

Endocarditis with Ruptured Cerebral Aneurysm Caused by Cardiobacterium valvarum sp. nov

Subspecies Identification and Significance of 257 Clinical Strains of Mycobacterium avium

Contact Info

Product

Resources

About