Rap1A Regulates Osteoblastic Differentiation via the ERK and p38 Mediated Signaling

Abstract

Rap1A is a member of small G proteins belonging to the Ras family. Recently, an integration of human genome-wide association studies (GWAS) and gene expression profiling study revealed that single-nucleotide polymorphisms (SNPs) within human Rap1A were strongly associated with narrow neck width in women. However, the regulatory role of Rap1A in osteoblasts remains to be elucidated. Here we report that Rap1A is a key regulator in osteoblast differentiation. Rap1A expression and activity were gradually enhanced during the induced differentiation of multipotent mesenchymal progenitor cells (C2C12) and preosteoblastic cells (MC3T3-E1). Knockdown of endogenous Rap1A significantly inhibited the osteogenic marker gene expression and matrix mineralization in cells with osteogenesis. In addition, knockdown of endogenous Rap1A suppressed the activation of extracellular signal-regulated kinase (ERK) and p38 mitogen-activated protein kinase (MAPK), while overexpression of Rap1A accelerated osteoblast differentiation and enhanced the phosphorylation of ERK and p38. Taken together, our study suggests that Rap1A regulates osteoblast differentiation through modulating the ERK/p38 signaling.

Activated Rap1A Induces Osteoblastic Differentiation and Cell Adhesion

“…These results are in agreement with those of previous reports [4] . During osteoblastic differentiation, Rap1 expression increases, which in turn promotes differentiation [4] .…”

“…During osteoblastic differentiation, Rap1 expression increases, which in turn promotes differentiation [4] . Although the mechanism for osteogenic differentiation remains unknown, Rap1 and PI3K/Akt signaling have been suggested to play important roles in the process [5] .…”

“…Mature osteoblasts produce a variety of bone-related proteins and extracellular matrix components, including runt-related transcription factor-2, alkaline phosphatase, collagen type I α-1, osteocalcin, osteopontin, osterix, and bone sialoprotein. Apotosis of osteoclasts is induced through the Bim/ caspase-3-dependent pathway or estrogen-induced Fas ligand, and osteoblastic differentiation of preosteoblasts is induced by Smad 1,5,8 phosphorylation by bone morphogenetic protein-2 or PI3K/Akt activation by transforming growth factor-β1 [3][4][5] . A small GTP-binding protein of the Ras family, Rap1, is involved in a variety of biological processes, including cell adhesion, migration, phagocytosis, morphogenesis, and development [6][7][8] .…”

Rap1A promotes ovarian cancer metastasis via activation of ERK/p38 and notch signaling

“…The DNA oligonucleotides were designed to generate shRNAs against the open reading frame of mRNA 5'‐ GCTCAGT CTACGTTTAATGAT‐3' (Rap1A shRNA1) and 5'‐ CCGAGCAATTTACAGCAATGA ‐3' (Rap1A shRNA2) to knockdown the expression of Rap1A. PLKO.1/Rap1A shRNA was generated according to the previously reported method …”

Osteogenic Effect of Inducible Nitric Oxide Synthase (iNOS)-Loaded Mineralized Nanoparticles on Embryonic Stem Cells

“…Ultimately, when differentially expressed genes were assigned to pathways using the KEGG mapper, we found three NO-driven pathways, namely the Rap1 and PI3K-Akt signaling pathways, and focal adhesion, which links different pathways. Previous studies have reported the connection between NO and these signaling pathways in osteoblastic activity [49][50][51][52]. Thus, we suggest that the NO signaling molecule can drive genetic and molecular pathways with implicated roles in ESC-osteogenic differentiation.…”