Rad54 protein stimulates heteroduplex DNA formation in the synaptic phase of DNA strand exchange via specific interactions with the presynaptic Rad51 nucleoprotein filament11Edited by M. Belfort

Solinger, Jachen A.; Lutz, Géraldine; Sugiyama, Tomohiko; Kowalczykowski, Stephen C.; Heyer, Wolf Dietrich

doi:10.1006/jmbi.2001.4555

Cited by 114 publications

(116 citation statements)

References 46 publications

Supporting

Mentioning

110

Contrasting

Order By: Relevance

“…The observation that stimulation saturates at lower than equimolar in some in vitro experiments can result from any number of factors. For instance, the maximal level of the stimulation observed in experiments with longer (kb-sized) ssDNA substrates was at ϳ1 Rad54 protein per 20 -50 Rad51 protein monomers (31). Because Rad51 protein forms more stable filaments with longer DNA substrates, saturating amounts of Rad54 protein would not necessarily be needed; furthermore, we found that with such DNA substrates (e.g.…”

Section: Discussionmentioning

confidence: 67%

“…At saturation, the binding stoichiometry of Rad54 protein within this joint complex is ϳ1:1 relative to Rad51 protein. Previously, based on enzymatic assays, Rad54 was inferred to interact with the assembled Rad51-ssDNA filament (24,31). This interaction leads to synergistic enhancement of the DNA pairing activity of Rad51 protein and, reciprocally, the dsDNA-dependent ATPase and the dsDNA topological unwinding activities of Rad54 protein.…”

Section: Discussionmentioning

confidence: 99%

“…Proteins and DNA-Saccharomyces cerevisiae Rad51 protein, RPA, and Rad54 protein were purified as described (18,31,32). The Rad54 protein is a glutathione S-transferase fusion protein that is fully active both in vivo (31) and in vitro (24).…”

Section: Methodsmentioning

confidence: 99%

“…The Rad54 protein is a glutathione S-transferase fusion protein that is fully active both in vivo (31) and in vitro (24). The oligonucleotides used in this study were as follows: number 2, 63-mer (TCCTTTTGATAAGAGGTC-ATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTG-T); 5, 32-mer (CCATCCGCAAAAATGACCTCTTATCAAAAGGA); 6, 32-mer (TCCTTTTGATAAGAGGTCATTTTTGCGGATGG); 26, 48-mer (TCCT TTTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAA-TTGC); 48, 48-mer (GCAATTAAGCTCTAAGCCATCCGCAAAAATGA-CCTCT TATCAAAAGGA-biotin); 77, 100-mer (biotin-GGGCTACGTC-TTGCTG GCGTTCGCGACGCGAGGCTGGTGGCCTTCCCCATTATG-* This work was supported by National Institutes of Health Grant GM-62653 (to S. C. K.), Drexel University College of Medicine startup funds, and Pennsylvania Health Research Formula Funds from the Tobacco Settlement Act (to A. V. M.).…”

Section: Methodsmentioning

confidence: 99%

“…Rad54 protein was discovered to have a dsDNA topology-modifying activity, and this activity was implicated in the mechanism of stimulation of DNA strand exchange (23,27). Previously, we inferred from the analysis of joint molecule formation by Rad51 protein that Rad54 protein binds to the assembled Rad51-ssDNA nucleoprotein filament (24,31). We suggested that Rad54 protein is a component of a nucleoprotein filament that is involved in the search for DNA homology, and, in that capacity, Rad54 protein modifies the topology of dsDNA-target, thereby making it more readily accessible for DNA pairing.…”

mentioning

confidence: 99%

See 4 more Smart Citations

A Novel Function of Rad54 Protein

Mazin¹,

Alexeev²,

Kowalczykowski³

2003

Journal of Biological Chemistry

157

View full text Add to dashboard Cite

Homologous recombination is important for the repair of double-stranded DNA breaks in all organisms. Rad51 and Rad54 proteins are two key components of the homologous recombination machinery in eukaryotes. In vitro, Rad51 protein assembles with singlestranded DNA to form the helical nucleoprotein filament that promotes DNA strand exchange, a basic step of homologous recombination. Rad54 protein interacts with this Rad51 nucleoprotein filament and stimulates its DNA pairing activity, suggesting that Rad54 protein is a component of the nucleoprotein complex involved in the DNA homology search. Here, using physical criteria, we demonstrate directly the formation of Rad54-Rad51-DNA nucleoprotein co-complexes that contain equimolar amounts of each protein. The binding of Rad54 protein significantly stabilizes the Rad51 nucleoprotein filament formed on either single-stranded DNA or double-stranded DNA. The Rad54-stabilized nucleoprotein filament is more competent in DNA strand exchange and acts over a broader range of solution conditions. Thus, the co-assembly of an interacting partner with the Rad51 nucleoprotein filament represents a novel means of stabilizing the biochemical entity central to homologous recombination, and reveals a new function of Rad54 protein.Homologous recombination plays an essential role in repair of DNA double-stranded breaks, a lethal type of DNA damage. The mechanisms of double-stranded break repair by recombination have been extensively investigated at the genetic and biochemical levels (1-6). In yeast, genetic analysis reveals a set of genes, called the RAD52 epistasis group, that are directly involved in double-stranded break repair (7). This group includes the RAD50, RAD58/MRE11, XRS2, RPA1, RAD51, RAD52, RAD54, RAD55, RAD57, and RAD59 genes. Among the proteins encoded by these genes, the Rad51 protein is the most evolutionarily conserved; its homologues are spread from bacteria to mammals (8). The Rad51 protein family members possess a unique property; they form helical nucleoprotein filaments with DNA (9 -11) and promote DNA pairing and strand transfer, a basic step of homologous recombination (11-16).More recently, it was demonstrated that Rad52 protein, Rad54 protein, and the Rad55/Rad57 heterodimer stimulate DNA pairing promoted by Rad51 protein. The mechanistic studies revealed that stimulation by Rad52 protein and the Rad55/Rad57 proteins is at the early (presynaptic) stage of DNA strand exchange. Rad52 protein enhances the ability of Rad51 protein to displace RPA from ssDNA 1 (17)(18)(19)(20), as do the Rad55/Rad57 proteins, but by a different mechanism (21).The mechanism by which Rad54 protein stimulates the DNA pairing activity of Rad51 protein is different (22-28). It was found that, in contrast to other proteins that stimulate the DNA pairing activity of Rad51 protein, Rad54 protein acts at a later (synaptic) stage of DNA strand exchange (24, 29). Rad54 protein belongs to the Snf2/Swi2 group of proteins, which are involved in ATP-dependent remodeling of protein complexes, in...

show abstract

Section: Discussionmentioning

confidence: 67%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

A Novel Function of Rad54 Protein

Mazin¹,

Alexeev²,

Kowalczykowski³

2003

Journal of Biological Chemistry

157

View full text Add to dashboard Cite

show abstract

Coordination of DNA replication and recombination activities in the maintenance of genome stability

2011

View full text Add to dashboard Cite

Across the evolutionary spectrum, living organisms depend on high-fidelity DNA replication and recombination mechanisms to maintain genome stability and thus to avoid mutation and disease. The repair of severe lesions in the DNA such as double-strand breaks or stalled replication forks requires the coordinated activities of both the homologous recombination and DNA replication machineries. Growing evidence indicates that so-called “accessory proteins” in both systems are essential for the effective coupling of recombination to replication that is necessary to restore genome integrity following severe DNA damage. In this article we review the major processes of homology-directed DNA repair (HDR), including the double Holliday Junction (dHJ), synthesis-dependent strand annealing (SDSA), break-induced replication (BIR), and error-free lesion bypass pathways. Each of these pathways involves the coupling of a homologous recombination event to DNA synthesis. We highlight two major classes of accessory proteins in recombination and replication that facilitate HDR: Recombination mediator proteins exemplified by T4 UvsY, S. cerevisiae Rad52, and human BRCA2; and DNA helicases/translocases exemplified by T4 Gp41/Gp59, E. coli DnaB and PriA, and eukaryotic Mcm2-7, Rad54, and Mph1. We illustrate how these factors help to direct the flow of DNA and protein-DNA intermediates on the pathway from a double-strand break or stalled replication fork to a high-fidelity recombination-dependent replication apparatus that can accurately repair the damage.

show abstract

Biochemistry of Eukaryotic Homologous Recombination

Heyer

Molecular Genetics of Recombination

View full text Add to dashboard Cite

The biochemistry of eukaryotic homologous recombination caught fire with the discovery that Rad51 is the eukaryotic homolog of the bacterial RecA and T4 UvsX proteins; and this field is still hot. The core reaction of homologous recombination, homology search and DNA strand invasion, along with the proteins catalyzing it, are conserved throughout evolution in principle. However, the increased complexity of eukaryotic genomes and the diversity of eukaryotic cell biology pose additional challenges to the recombination machinery. It is not surprising that this increase in complexity coincided with the evolution of new recombination proteins and novel support pathways, as well as changes in the properties of those eukaryotic recombination proteins that are evidently conserved in evolution. In humans, defects in homologous recombination lead to increased cancer predisposition, underlining the importance of this pathway for genomic stability and tumor suppression. This review will focus on the mechanisms of homologous recombination in eukaryotes as elucidated by the biochemical analysis of yeast and human proteins.

show abstract

Rad54 protein stimulates heteroduplex DNA formation in the synaptic phase of DNA strand exchange via specific interactions with the presynaptic Rad51 nucleoprotein filament11Edited by M. Belfort

Cited by 114 publications

References 46 publications

A Novel Function of Rad54 Protein

A Novel Function of Rad54 Protein

Coordination of DNA replication and recombination activities in the maintenance of genome stability

Biochemistry of Eukaryotic Homologous Recombination

Contact Info

Product

Resources

About