RAC, a stable ribosome-associated complex in yeast formed by the DnaK-DnaJ homologs Ssz1p and zuotin

Abstract

The yeast cytosol contains multiple homologs of the DnaK and DnaJ chaperone family. Our current understanding of which homologs functionally interact is incomplete. Zuotin is a DnaJ homolog bound to the yeast ribosome. We have now identified the DnaK homolog Ssz1p͞Pdr13p as zuotin's partner chaperone. Zuotin and Ssz1p form a ribosome-associated complex (RAC) that is bound to the ribosome via the zuotin subunit. RAC is unique among the eukaryotic DnaK-DnaJ systems, as the 1:1 complex is stable, even in the presence of ATP or ADP. In vitro, RAC stimulates the translocation of a ribosome-bound mitochondrial precursor protein into mitochondria, providing evidence for its chaperonelike effect on nascent chains. In agreement with the existence of a functional complex, deletion of each RAC subunit resulted in a similar phenotype in vivo. However, overexpression of zuotin partly rescued the growth defect of the ⌬ssz1 strain, whereas overexpression of Ssz1p did not affect the ⌬zuo1 strain, suggesting a pivotal function for the DnaJ homolog. P roteins synthesized on cytosolic ribosomes either fold or translocate to their final location cotranslationally or posttranslationally. Translocation and folding require chaperonelike proteins that often serve multiple and overlapping functions. The complex chaperone network in the eukaryotic cell is currently only poorly understood (1-3).Most posttranslational translocation events require the translocating proteins to be unfolded. This requirement is at least partly ensured by binding of cytosolic chaperones to newly translated proteins. The yeast DnaK͞Hsp70 homolog Ssa1͞2p and its partner protein, the DnaJ homolog Ydj1p, are involved in protein translocation into a variety of compartments (4). Besides their role in translocation, Ssa1͞2p and Ydj1p are involved in cytosolic protein folding, most likely in a posttranslational manner (5-7). Other chaperones assisting posttranslational folding in the eukaryotic cytosol are the chaperonin CCT and Hsp90 (2,8,9).Some chaperones interact cotranslationally with polypeptides. In both eukaryotes and prokaryotes, soluble DnaK and DnaJ homologs bind to nascent chains and subsequently assist their folding (2, 10, 11). The ribosome-bound DnaK homolog Ssb1͞2p can be crosslinked to nascent chains, providing evidence for a functionally important interaction (12).There is long-standing circumstantial evidence of cotranslational import into mitochondria (13). More recent data suggest that some precursor proteins even require a cotranslational mechanism to be imported into mitochondria (14-16). However, no specialized component of a mitochondrial cotranslational translocation system, comparable to a signal recognition particle or signal recognition particle receptor, has been identified (17).In a previous study we introduced an in vitro mitochondrial protein import assay for the identification of cytosolic components involved in either cotranslational translocation or interacting with nascent precursor proteins in a chaperone-like manner. The assay, b...

Divergent Functional Properties of the Ribosome-Associated Molecular Chaperone Ssb Compared with Other Hsp70s

“…12, December 2001supported by results demonstrating the DnaK mutant proteins F426S, S427P, and V436F show a lower affinity for peptide and are unable to substitute for DnaK in vivo (Montgomery et al, 1999;Mayer et al, 2000).…”

The ribosome-associated complex antagonizes prion formation in yeast

“…The zuo1::HIS3 and ssz1::LYS2 alleles have been described previously. 35,36 Strains expressing chaperone-GFP fusions were generated by crossing the zuo1:: KAN r allele derived from the deletion collection 75 (or the HIS3::KAN r allele as a wildtype control) into GFP-tagged strains from the GFP collection, 42 For prion induction assays, strains were transformed with a plasmid encoding the Sup35 N and M domains with a C-terminal GFP fusion under the control of the GAL1 promoter (pRS426 Gal1pr-Sup35NM-GFP). To CATTAAAAGAACGTACATATAGCGATACAAACGTATAGCAAAGATCTGAAGGTCGACGGATCCCCGGGTT P2 TATATAAACAAATACGTAAACAAAGGATAGAAGGCGAACTGAATCATCGTTCGATGAATTCGAGCTCGTT P3 GATAGCGGTTCCATTGTCGT P4 CTGCAGCGAGGAGCCGTAAT P5 CCTTGGGAATTGTTACCTGAC P6 GCTACTCGAGGGATGGACGCAAAGAAGTTTAATAATC P7 GCTAGGATCCGTTTTTTCTCCTTGACGTTAAAGTATAG P8 GGTAGGTAGCGGCCGCAAATCGTAGCGCGATGAGAC P9 GCTAGGATCCCATACCGCCAAAATTTCCAA P10 CATCGGCAACAAAATCACATGATCTGAAACGCAACTTAGACAAACCC P11 GGGTTTGTCTAAGTTGCGTTTCAGATCATGTGATTTTGTTGCCGATG P12 GCATCACCAAAGTAGTCAGCTTCATCTTCACTGACAGCTCTTTCAAC P13 GTTGAAAGAGCTGTCAGTGAAGATGAAGCTGACTACTTTGGTGATGC construct this plasmid, a 628 base pair fragment of the GAL1 promoter was PCR amplified from genomic DNA with primers (P6 and P7) that introduced XhoI and BamHI restriction sites ( Table 1).…”

“…Zuo1 is central to RAC function as it anchors the RAC onto the ribosome and stimulates Ssb activity via its J domain; deletion of Zuo1 therefore eliminates RAC function on the ribosome. [35][36][37] Sup35 conversion to a [PSI C ] conformation enhances nonsense suppression of the premature stop codon in the ade1-14 allele and is thus accompanied by conversion to an Ade C phenotype. In wildtype cells, approximately 2% of the population had converted to Ade C following Sup35NM over-expression for 36 hours.…”

“…35,36 Neither the peptide binding domain nor the ATPase activity of Ssz1 is required for RAC function in vivo. 53,54 Thus, the importance of ribosome-association and Ssb stimulation for the anti-prionogenic function of the RAC can be assessed by deleting those 2 functional regions of Zuo1.…”

“…31 Although the function of the NAC is poorly defined, it is thought to have roles in co-translational protein folding 32 and in protein targeting to mitochondria 33 and the endoplasmic reticulum. 34 The RAC consists of the Heat Shock Protein (Hsp) 70/40 pair Ssz1/ Zuo1, 35 which is anchored to the ribosome in close proximity to the polypeptide exit tunnel via a charged C-terminal region of Zuo1. 36,37 The RAC stimulates the ATPase activity of ribosome-associated Hsp70 Ssb chaperones to protect nascent chains from misfolding and aggregation.…”