Quantitative assessment of the effects of sulfamethoxazole on  Toxoplasma gondii  loads in susceptible WT C57BL/6 mice as an immunocompetent host model

Belal, Usama S.; Norose, Kazumi; Mohamed, Rabie M.; Sekine, Satoshi; Nukaga, Takumi; Ito, Kousei; Abdellatif, Manal Z. M.; Abdelgelil, Noha H.; Yano, Akihiko

doi:10.1016/j.parint.2015.09.004

Cited by 4 publications

(7 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Other inhibitors of DHFR were considerably less potent, including methotrexate 53–54 and cycloguanil 55–56 , consistent with previous reports (Table 1). As expected, sulfa drugs were also less potent including sulfadiazine, sulfamethoxoazole, and dapsone (Table 1), consistent with previous reports of their in vitro activity 52, 57–58 . The low activity of these molecules vitro may reflect high levels of p- araminobenzoic acid in culture medium, as this metabolite acts competitively with these inhibitors of DHPS.…”

Section: Resultssupporting

confidence: 91%

Evaluation of Current and Emerging Antimalarial Medicines for Inhibition of Toxoplasma gondii Growth in Vitro

et al. 2018

View full text Add to dashboard Cite

Toxoplasma gondii is a common zoonotic infection of humans, and estimates indicate that 1-2 billion people are chronically infected. Although largely asymptomatic, chronic infection poses risk of serious disease due to reactivation should immunity decline. Current therapies for toxoplasmosis only control acute infection caused by actively proliferating tachyzoites but do not eradicate the chronic tissue cyst stages. As well, there are considerable adverse side effects of the most commonly used therapy of combined sulfadiazine and pyrimethamine. Targeting the folate pathway is also an effective treatment for malaria, caused by the related parasites Plasmodium spp., suggesting common agents might be used to treat both infections. Here, we evaluated currently approved and newly emerging medicines for malaria to determine if such compounds might also prove useful for treating toxoplasmosis. Surprisingly, the majority of antimalarial compounds being used currently or in development for treatment of malaria were only modestly effective at inhibiting in vitro growth of T. gondii tachyzoites. These findings suggest that many essential processes in P. falciparum that are targeted by antimalarial compounds are either divergent or nonessential in T. gondii, thus limiting options for repurposing of current antimalarial medicines for toxoplasmosis.

show abstract

Section: Resultssupporting

confidence: 91%

Evaluation of Current and Emerging Antimalarial Medicines for Inhibition of Toxoplasma gondii Growth in Vitro

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Results of the screen are summarized in Table 1 and cycloguanil (55,56), consistent with previous reports ( Table 1). As expected, sulfa drugs were also less potent including sulfadiazine, sulfamethoxoazole, and dapsone (Table 1), consistent with previous reports of their in vitro activity (52,57,58). The low activity of these molecules vitro may reflect high levels of p-araminobenzoic acid in culture medium, as this metabolite acts competitively with these inhibitors of DHPS.…”

Section: Resultssupporting

confidence: 90%

Evaluation of current and emerging anti-malarial medicines for inhibition ofToxoplasma gondiigrowth in vitro

Radke¹,

Burrows

Goldberg³

et al. 2018

Preprint

View full text Add to dashboard Cite

Toxoplasma gondii is a common zoonotic infection of humans and estimates indicate that 1-2 billion people are chronically infected. Although largely asymptomatic, chronic infection poses risk of serious disease due to reactivation should immunity decline.Current therapies for toxoplasmosis only control acute infection caused by actively proliferating tachyzoites but do not eradicate the chronic tissue cyst stages. As well, there are considerable adverse side effects of the most commonly used therapy of combined sulfadiazine and pyrimethamine. Targeting the folate pathway is also an effective treatment for malaria, caused by the related parasites Plasmodium spp., suggesting common agents might be used to treat both infections. Here we evaluated currently approved and newly emerging medicines for malaria to determine if such compounds might also prove useful for treating toxoplasmosis. Surprisingly, the majority of anti-malarial compounds being used currently or in development for treatment of malaria were only modestly effective at inhibiting in vitro growth of T. gondii tachyzoites. These findings suggest that many essential processes in P. falciparum that are targeted by anti-malarial compounds are either divergent, or non-essential in T.gondii, thus limiting options for repurposing of current antimalarial medicines for toxoplasmosis.

show abstract

“…Genome-wide screening for gene fitness suggests that disruption of TgGP (in the type I RH strain) does not affect fitness under tachyzoite culture conditions (phenotype enrichment score of 1.01) ( 16 ). A direct competition assay with parasites with a silence mutation or stop codon mutation at the first exon of TgGP has shown that around 2 to 3 weeks are required to detect a growth difference between the TgGP knockout strain and wild-type parasites in a Pru Δku80Δhxgprt strain background ( 17 ). This suggests that TgGP is dispensable for tachyzoite growth under normal tissue culture conditions.…”

Section: Discussionmentioning

confidence: 99%

“…To mutate a codon at the Ser25 position of GP in the native genome locus, p-DHFR-Cas9GFP-sgGP (single guide RNA [sgRNA] target sequence, GCTTGGAAAATGACGCCTTT) and donor DNA were prepared as previously described ( 17 ) using primers listed in Table S1 . After cotransfection of the circular p-DHFR-Cas9GFP-sgGP and linearized donor DNA as described in reference 17 , parasites which incorporated transfected DNA were selected using 1 µM pyrimethamine for 10 days. After the initial selection, the drug was removed, parasites were cloned by limiting dilution, and the genotype was checked by sequencing the target region.…”

Section: Methodsmentioning

confidence: 99%

Toxoplasma gondii Requires Glycogen Phosphorylase for Balancing Amylopectin Storage and for Efficient Production of Brain Cysts

Sugi

et al. 2017

mBio

View full text Add to dashboard Cite

In immunocompromised hosts, latent infection with Toxoplasma gondii can reactivate from tissue cysts, leading to encephalitis. A characteristic of T. gondii bradyzoites in tissue cysts is the presence of amylopectin granules. The regulatory mechanisms and role of amylopectin accumulation in this organism are not fully understood. The T. gondii genome encodes a putative glycogen phosphorylase (TgGP), and mutants were constructed to manipulate the activity of TgGP and to evaluate the function of TgGP in amylopectin storage. Both a stop codon mutant (Pru/TgGPS25stop [expressing a Ser-to-stop codon change at position 25 in TgGP]) and a phosphorylation null mutant (Pru/TgGPS25A [expressing a Ser-to-Ala change at position 25 in TgGp]) mutated at Ser25 displayed amylopectin accumulation, while the phosphorylation-mimetic mutant (Pru/TgGPS25E [expressing a Ser-to-Glu change at position 25 in TgGp]) had minimal amylopectin accumulation under both tachyzoite and bradyzoite growth conditions. The expression of active TgGPS25S or TgGPS25E restored amylopectin catabolism in Pru/TgGPS25A. To understand the relation between GP and calcium-dependent protein kinase 2 (CDPK2), which was recently reported to regulate amylopectin consumption, we knocked out CDPK2 in these mutants. PruΔcdpk2/TgGPS25E had minimal amylopectin accumulation, whereas the Δcdpk2 phenotype in the other GP mutants and parental lines displayed amylopectin accumulation. Both the inactive S25A and hyperactive S25E mutant produced brain cysts in infected mice, but the numbers of cysts produced were significantly less than the number produced by the S25S wild-type GP parasite. Complementation that restored amylopectin regulation restored brain cyst production to the control levels seen in infected mice. These data suggest that T. gondii requires tight regulation of amylopectin expression for efficient production of cysts and persistent infections and that GP phosphorylation is a regulatory mechanism involved in amylopectin storage and utilization.

show abstract

Quantitative assessment of the effects of sulfamethoxazole on Toxoplasma gondii loads in susceptible WT C57BL/6 mice as an immunocompetent host model

Cited by 4 publications

References 21 publications

Evaluation of Current and Emerging Antimalarial Medicines for Inhibition of Toxoplasma gondii Growth in Vitro

Evaluation of Current and Emerging Antimalarial Medicines for Inhibition of Toxoplasma gondii Growth in Vitro

Evaluation of current and emerging anti-malarial medicines for inhibition ofToxoplasma gondiigrowth in vitro

Toxoplasma gondii Requires Glycogen Phosphorylase for Balancing Amylopectin Storage and for Efficient Production of Brain Cysts

Contact Info

Product

Resources

About