Quantitative Analysis of Stall of Replicating DNA Polymerase by G-Quadruplex Formation

Takahashi, Shuntaro; Sugimoto, Naoki

doi:10.1007/978-1-4939-9666-7_15

Cited by 4 publications

(6 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this replication assay, the ability of a G4-binding ligand to impede DNA replication is measured. We therefore compared the inhibitory effects of the enantiomers of complex ( I ) on DNA replication using the Klenow fragment (3′ → 5′ exo−). − In this well-developed assay, a time course plotting the rates of the generation of an intermediate stalled replication product followed by a completed full length duplex is compared . The stabilization of the G-quadruplex by the binding of an appropriate ligand gives a slower rate of the unfolding of the structure, and a detailed interpretation of such data for a range of G4-binding ligands has recently been published .…”

Section: Resultsmentioning

confidence: 99%

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

et al. 2022

Self Cite

View full text Add to dashboard Cite

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

show abstract

Section: Resultsmentioning

confidence: 99%

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

et al. 2022

Self Cite

View full text Add to dashboard Cite

show abstract

“…This assay was performed as previously described 49 , 74 . The 5′-end FAM labeled primer (5′-FAM-TAATACGACTCACTATAGCAATTGC) was mixed with template DNA in a 1.2:1 equivalent (5′- TGAATCCTGAGGGCGGTGTGGGAAGAGGGAAGATAGCTGCACGCAATTGCTATAGTGAGTCGTATTA-3′).…”

Section: Methodsmentioning

confidence: 99%

Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine

Wang

Liu

et al. 2022

Nat Commun

View full text Add to dashboard Cite

KRAS is one of the most highly mutated oncoproteins, which is overexpressed in various human cancers and implicated in poor survival. The G-quadruplex formed in KRAS oncogene promoter (KRAS-G4) is a transcriptional modulator and amenable to small molecule targeting. However, no available KRAS-G4-ligand complex structure has yet been determined, which seriously hinders the structure-based rational design of KRAS-G4 targeting drugs. In this study, we report the NMR solution structures of a bulge-containing KRAS-G4 bound to berberine and coptisine, respectively. The determined complex structure shows a 2:1 binding stoichiometry with each compound recruiting the adjacent flacking adenine residue to form a “quasi-triad plane” that stacks over the two external G-tetrads. The binding involves both π-stacking and electrostatic interactions. Moreover, berberine and coptisine significantly lowered the KRAS mRNA levels in cancer cells. Our study thus provides molecular details of ligand interactions with KRAS-G4 and is beneficial for the design of specific KRAS-G4-interactive drugs.

show abstract

“…In the plant other alkaloids are also present, such as californidine and escholtzine, which are the major ones, as well as sanguinarine, sanguirubine, or macarpine [16]. Recent studies highlight the potential importance of non-canonical forms of DNA, such as G-quadruplex (G4) or i-motif, in replication, transcription, or translation processes and mRNA splicing [17][18][19]. Non-canonical DNA structures are characterized by their specific sequence.…”

Section: Introductionmentioning

confidence: 99%

“…In addition to pH, the temperature and length, and structure of the loop also affect the stability of i-motif [31,32]. Due to the influence of pH on its stability, Recent studies highlight the potential importance of non-canonical forms of DNA, such as G-quadruplex (G4) or i-motif, in replication, transcription, or translation processes and mRNA splicing [17][18][19]. Non-canonical DNA structures are characterized by their specific sequence.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Alkaloid Escholidine and Its Interaction with DNA Structures

Jarošová

Hannig

Kolková

et al. 2021

Biology

View full text Add to dashboard Cite

Berberine, the most known quaternary protoberberine alkaloid (QPA), has been reported to inhibit the SIK3 protein connected with breast cancer. Berberine also appears to reduce the bcl-2 and XIAP expression-proteins responsible for the inhibition of apoptosis. As some problems in the therapy with berberine arose, we studied the DNA binding properties of escholidine, another QPA alkaloid. CD, fluorescence, and NMR examined models of i-motif and G-quadruplex sequences present in the n-myc gene and the c-kit gene. We provide evidence that escholidine does not induce stabilization of the i-motif sequences, while the interaction with G-quadruplex structures appears to be more significant.

show abstract

Quantitative Analysis of Stall of Replicating DNA Polymerase by G-Quadruplex Formation

Cited by 4 publications

References 10 publications

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine

Alkaloid Escholidine and Its Interaction with DNA Structures

Contact Info

Product

Resources

About