Quantification of Llama Inflammatory Cytokine mRNAs by Real-Time RT-PCR

Abstract

ABSTRACT. We have developed a method by which llama cytokine mRNAs can be quantified using real-time reverse transcription polymerase chain reaction (RT-PCR). Total RNA was extracted from lipopolysaccharide (LPS)-stimulated peripheral blood mononuclear cells (PBMCs) of llama, reverse transcribed to cDNA, and cytokine profiles for interleukin (IL)-1α, IL-1β, IL-6 and tumor necrosis factor (TNF) α were quantified by real-time PCR. The expressions of mRNAs of inflammatory cytokines IL-1α, IL-1β, IL-6 and TNFα were upregulated upon stimulation with LPS in a dose-and time-dependent manner. Incubation of PBMCs with 100 and 1,000 pg/ml of LPS for 3 to 6 hr resulted in the acceleration of the mRNA levels of inflammatory cytokines. Here, we describe a highly sensitive and reproducible method to quantify the transcription of llama cytokine mRNAs by real-time RT-PCR with the double-stranded DNA-binding dye SYBR Green I. KEY WORDS: Llama, LPS, real-time RT-PCR.J. Vet. Med. Sci. 67(2): 195-198, 2005 The important roles of cytokines in the regulation of immune and inflammatory responses are now clearly recognized [10]. Inflammatory cytokines are known as some of the immune mediators at inflammatory sites and appear to play an important role in the pathological processes of inflammatory lesions. IL-1, IL-6 and TNFα are multifunctional cytokines and known as activators of lymphocytes and macrophages [1,6]. The host response to gram-negative bacterial infections, mainly studied in mice, human beings and other mammals, includes production of inflammatory cytokines such as IL-1α, IL-1β, IL-6 and TNFα. Bacterial lipopolysaccharide (LPS) is a key inducer of the inflammatory response following gram-negative infection [9].The llama belongs to the family Camelidae and they are specially suited to the harsh environment. Llama and camel are relatively healthy, although they can be infected with many pathogens [3,7,12,13,15,17], which infect cattle, sheep and horse. However, the roles of inflammatory cytokines such as IL-1, IL-6 and TNFα in bacterial infections are not well understood in Camelidae. Previously, we reported the cloning of several llama cytokines and these sequences are now available for the design of llama-specific primers [11 and Genebank databases]. The aim of the present study was to characterize the immune response in llama, experimentally induced with LPS, by quantification of cytokine mRNAs in the PBMCs using real-time PCR.PBMCs were purified by density gradient centrifugation on Percoll (Amersham-Pharmacia, UK) from heparinized venous blood of a healthy 3-year-old llama maintained in the experimental animal facility unit of our laboratory. PBMCs were cultured with two different concentrations of LPS (100 and 1,000 pg/ml) for three different incubation periods of early (3 and 6 hr), intermediate (12 and 24 hr) and late (48 and 72 hr). LPS derived from E. coli 055:B5, Bacto (Wako, Japan) was used for endotoxic bacterial stimulation. Total RNA was isolated from LPS-stimulated and control (without LPS) PBMCs using the...

Cytokine Responses in Camels (Camelus bactrianus) Vaccinated with Brucella abortus strain 19 Vaccine

“…Real-time reverse transcription polymerase chain reaction (RT-PCR) is becoming widely used to quantify cytokines derived from cells and tissues [20]. We previously described a method by which llama inflammatory cytokine mRNAs can be quantified using real-time RT-PCR technology with the double-stranded DNA-binding dye SYBR Green I [13]. In the field of camel immunology, realtime PCR has not been used to measure cytokine mRNAs and has only been used in limited studies on camel brucellosis.…”

“…The real-time PCR assay was performed using the same conditions and the oligonucleotide primers described by Odbileg et al [13]. Other newly designed primer sequences used are as follows: AAACTCTCCAGGAT-GCTCAC, forward, and GGAACTGAAGGGATCT-GAAA, reverse, for IL-2; CAAAGAACACAACT GAGAAG, forward, and GGCTAAAGAAGATTAT-GAAG, reverse, for IL-4; AAGCCTTGTCGGAGATGAC, forward, and AGCCATGAGTGAGTTCGACA, reverse, for IL-10; ATTGTCTCCTTCTACTTCAA, forward, and AGCGGAAGAGAAGTCAGAAT, reverse, for IFN-γ.…”

“…To quantify the cytokine expression by real-time PCR, we used plasmid cDNA as standards. The standard curve was prepared for each target cytokine as described previously [13].…”

Expresión de Citocinas Pro-Inflamatorias de Leucocitos de Alpaca (Vicugna pacos) Inducidos por el Extracto de Macroquistes de Sarcocystis aucheniae

“…Para esto se utilizó el ADN complementario (ADNc) de los ARN totales obtenidos en el paso anterior (RT). Asimismo, se emplearon los oligonucleótidos específicos de llama descritos por Odbileg et al (2005) Para la reacción en tiempo real se empleó el kit SuperScript™ III Platinum® SYBR® Green Two-Step qRT-PCR Kit with ROX (Invitrogen, EEUU), de acuerdo a las instrucciones del fabricante. Se utilizó el termociclador mencionado anteriormente, empleándose protocolos de acuerdo a la temperatura de disociación de cada juego de oligonucleótidos (Odbileg et al, 2005).…”

Molecular Cloning and Phylogenetic Analysis of Inflammatory Cytokines of Camelidae (Llama and Camel)

“…Recently, llama Th1 (IL-2, IFN-γ and IL-12) and Th2 (IL-4, IL-10 and IL-13) cytokines were cloned and sequenced [18,19]. Previously, we reported the quantification of llama inflammatory cytokine mRNAs by real-time PCR [17]. However, no sequence data have been reported for inflammatory cytokines (IL-1, IL-6 and TNF-α of the Camelidae.…”