Quality of metagenomic DNA extracted for molecular identification of microorganisms from CSF samples of patients with suspected cerebrospinal meningitis in northern Nigeria

Abstract

Background: Following an increase in the practice of starting antimicrobial therapy prior to clinical sample collection, the ability to confirm pathogenic microorganisms of bacterial meningitis has decreased by approximately 30%. Culture results may be false negative when fastidious or culture-resistant bacteria are involved or when patient samples are obtained after antimicrobial therapy has started. Molecular diagnosis using PCR can be performed directly on clinical samples after metagenomic DNA (mDNA) extraction not requiring live organisms for a positive result. The specific objectives of this study are to perform mDNA extraction directly from cerebrospinal fluids (CSF) using appropriate spin column method, and to determine the quality of the mDNA elute.Methodology: Cerebrospinal fluid specimens were collected from 210 patients with suspected acute cerebrospinal meningitis (CSM) in the Federal Capital Territory and some States in Northern Nigeria during the 2017 and 2018 outbreak seasons. Metagenomic DNA was extracted from approximately 200µL of CSF specimens using the Qiagen QIAamp(R) DNA Mini kit specific for bacterial agents only. DNA quality check was performed on all DNA elutes using fluorometric, spectrophotometric and agarose gel electrophoresis methods.Results: Of the 210 CSF samples analyzed microbiologically, Gram reaction was positive in 94 cases (44.8 %) but only 17 (8.1 %) were culture positive for two of the three major bacterial causes of meningitis. One hundred and eighty (85.7%) samples had DNA concentrations ≥ 0.005 ng/µL, 55 (30.6 %) of these had DNA purity (A260/A280) of ≥ 1.7, 103 (57.2%) had purity value between 1.0 - 1.69, 14 (7.8%) had value of 0.57 - 0.99, and 8 (4.4%) failed purity evaluation with value of 0.00 at A260/A280.Conclusion: The essence of mDNA extraction is multipurpose. A multiplex PCR can be performed on the extracted mDNA to interrogate the presence of microbial pathogens of interest using specific primers and probes (when applicable). Quality mDNA from CSF samples will ensure successful qPCR results for rapid and accurate detection of bacterial pathogens in meningitis. This will eliminate the challenges associated with traditional culture methods.
 Keywords: Meningitis, CSF, DNA Quality Check, Fluorometry

Epidemic forecast and preparedness for explosive-cerebrospinal meningitis outbreak in Nigeria using the preventive vaccination strategy

“…In low-resource countries like Nigeria, the laboratory diagnostic methods used are presumptive identification of aetiologies made on the basis of cytological examination of the CSF, specific colony morphology on blood and or chocolate agar, staining properties on Gram stain or by detection of specific antigens in the CSF by latex agglutination test or a rapid diagnostic test, 22 and the metagenomic protocol for use with molecular methods. 23 There were 10 articles that fell within this category with prevalence rates ranging from 1.7% to 20.4%. 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 Two studies also utilised the molecular approach in the identification of bacterial aetiologies.…”

“…Finally, our recommendations in this review article are relevant for tackling both annual and explosive meningitis outbreaks. 23,33,44,45,46 led to this review article. Finally, we appreciate Pollett and colleagues 89 for use of their guidelines and their guidance in reporting items for epidemic forecasting.…”

“…Also appreciated are all staff of Safety Molecular Pathology Laboratory, Enugu, Enugu State, Nigeria, for the various roles they played in the course of running of all samples for preparation of metagenomic deoxyribonucleic acid template and actual molecular diagnostic procedures. The outcome of the main original research already published (Peletiri et al 2021a; 2021b; 2022a; 2022b; 2022c) 23 , 33 , 44 , 45 , 46 led to this review article. Finally, we appreciate Pollett and colleagues 89 for use of their guidelines and their guidance in reporting items for epidemic forecasting.…”

“…All staff of the various laboratories where the original research samples were received and phenotypically processed are appreciated (Peletiri et al 2021a; 2021b). 23 , 33 Also, we wish to appreciate the Managing Director and Chief Executive Officer of Safety Molecular Pathology Laboratory, Enugu, Enugu State, Nigeria, Dr Emmanuel Nna (Doctor of Philosophy), for training the principal investigator in the practical application of metagenomic protocol and general orientation in molecular diagnostic techniques in the polymerase chain reaction laboratory of his institute. Also appreciated are all staff of Safety Molecular Pathology Laboratory, Enugu, Enugu State, Nigeria, for the various roles they played in the course of running of all samples for preparation of metagenomic deoxyribonucleic acid template and actual molecular diagnostic procedures.…”

Heavy‐metal tolerant bacterial strains isolated from industrial sites and scrap yards in Kashmir, India

“…The ratio of A 260 /A 280 was calculated, and the DNA sample having a ratio of 1.7-1.9 was considered for future use [38]. The polymerase chain reaction (PCR) amplification of the 16 S rDNA gene was achieved by using two universal primers (27 f = 5'AGAGTTTGATCCTGGCTCAG 3' and 1492r= GTTTACCTTGTTACGACTT).…”