Pyrosequencing of prey DNA in reptile faeces: analysis of earthworm consumption by slow worms

Brown, David Steven; Jarman, Simon; Symondson, William Oliver Christian

doi:10.1111/j.1755-0998.2011.03098.x

Cited by 70 publications

(59 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A single pair of general invertebrate primers was selected for amplification of predator gut contents; LCO‐1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) (Folmer, Black, Hoeh, Lutz, & Vrijenhoek, ) and HCO‐1777 (5′‐ACTTATATTGTTTATACGAGGGAA‐3′) (Brown, Jarman, & Symondson, ), which target a 287‐bp fragment of invertebrate CO1 genes. Blocking probes were not used as the phylogenetic proximity of predator and prey made it likely that a blocking probe would prevent amplification of many prey species (Piñol, Mir, Gomez‐Polo, & Agustí, ).…”

Section: Methodsmentioning

confidence: 99%

The effects of pastoral intensification on the feeding interactions of generalist predators in streams

et al. 2017

View full text Add to dashboard Cite

Land‐use change can alter trophic interactions with wide‐ranging functional consequences, yet the consequences for aquatic food webs have been little studied. In part, this may reflect the challenges of resolving the diets of aquatic organisms using classical gut contents analysis, especially for soft‐bodied prey. We used next‐generation sequencing to resolve prey use in nearly 400 individuals of two predatory invertebrates (the Caddisfly, Rhyacophila dorsalis, and the Stonefly Dinocras cephalotes) in streams draining land with increasingly intensive livestock farming. Rhyacophila dorsalis occurred in all streams, whereas D. cephalotes was restricted to low intensities, allowing us to test whether: (i) apparent sensitivity to agriculture in the latter species reflects a more specialized diet and (ii) diet in R. dorsalis varied between sites with and without D. cephalotes. DNA was extracted from dissected gut contents, amplified without blocking probes and sequenced using Ion Torrent technology. Both predators were generalists, consuming 30 prey taxa with a preference for taxa that were abundant in all streams or that increased with intensification. Where both predators were present, their diets were nearly identical, and R. dorsalis's diet was virtually unchanged in the absence of D. cephalotes. The loss of D. cephalotes from more intensive sites was probably due to physicochemical stressors, such as sedimentation, rather than to dietary specialization, although wider biotic factors (e.g., competition with other predatory taxa) could not be excluded. This study provides a uniquely detailed description of predator diets along a land‐use intensity gradient, offering new insights into how anthropogenic stressors affect stream communities.

show abstract

Section: Methodsmentioning

confidence: 99%

The effects of pastoral intensification on the feeding interactions of generalist predators in streams

et al. 2017

View full text Add to dashboard Cite

show abstract

“…) and lizards (Brown et al . ). Likewise, amplification of microbial DNA in skin swabs from several species of cohabiting frogs provided insight into processes underlying biogeographic patterns of free‐living vs. host‐associated microbiota (McKenzie et al .…”

Section: Introductionmentioning

confidence: 97%

Protocols for metagenomic DNA extraction and Illumina amplicon library preparation for faecal and swab samples

Jedlicka

2014

Molecular Ecology Resources

View full text Add to dashboard Cite

Next-generation sequencing (NGS) technology has extraordinarily enhanced the scope of research in the life sciences. To broaden the application of NGS to systems that were previously difficult to study, we present protocols for processing faecal and swab samples into amplicon libraries amenable to Illumina sequencing. We developed and tested a novel metagenomic DNA extraction approach using solid phase reversible immobilization (SPRI) beads on Western Bluebird (Sialia mexicana) samples stored in RNAlater. Compared with the MO BIO PowerSoil Kit, the current standard for the Human and Earth Microbiome Projects, the SPRI-based method produced comparable 16S rRNA gene PCR amplification from faecal extractions but significantly greater DNA quality, quantity and PCR success for both cloacal and oral swab samples. We furthermore modified published protocols for preparing highly multiplexed Illumina libraries with minimal sample loss and without post-adapter ligation amplification. Our library preparation protocol was successfully validated on three sets of heterogeneous amplicons (16S rRNA gene amplicons from SPRI and PowerSoil extractions as well as control arthropod COI gene amplicons) that were sequenced across three independent, 250-bp, paired-end runs on Illumina's MiSeq platform. Sequence analyses revealed largely equivalent results from the SPRI and PowerSoil extractions. Our comprehensive strategies focus on maximizing efficiency and minimizing costs. In addition to increasing the feasibility of using minimally invasive sampling and NGS capabilities in avian research, our methods are notably not avian-specific and thus applicable to many research programmes that involve DNA extraction and amplicon sequencing.

show abstract

“…It is now possible to identify even the rarest prey from multiple predators to species, genus, or family level in a single sequencing run while maintaining the ability to trace back each prey to the sample from which it came. NGS has been used in barcoding diet studies for fur seals [13], little penguins [14,15], slow worms [16], bats [17,18], leopard cats [19] and tapirs [20]. However prey identification from DNA in diet samples can be greatly influenced by technical issues including the uncertainty about the taxonomic diversity expected in the sample and the poor quality of the genomic DNA, particularly when extracted from fecal samples.…”

Section: Introductionmentioning

confidence: 99%

From Puffins to Plankton: A DNA-Based Analysis of a Seabird Food Chain in the Northern Gulf of Maine

2013

View full text Add to dashboard Cite

The predator-prey interactions within food chains are used to both characterize and understand ecosystems. Conventional methods of constructing food chains from visual identification of prey in predator diet can suffer from poor taxonomic resolution, misidentification, and bias against small or completely digestible prey. Next-generation sequencing (NGS) technology has become a powerful tool for diet reconstruction through barcoding of DNA in stomach content or fecal samples. Here we use multi-locus (16S and CO1) next-generation sequencing of DNA barcodes on the feces of Atlantic puffin (Fratercula arctica) chicks (n=65) and adults (n=64) and the stomach contents of their main prey, Atlantic herring (Clupea harengus, n=44) to investigate a previously studied food chain. We compared conventional and molecular-derived chick diet, tested the similarity between the diets of puffin adults and chicks, and determined whether herring prey can be detected in puffin diet samples. There was high variability in the coverage of prey groups between 16S and CO1 markers. We identified more unique prey with our 16S compared to CO1 barcoding markers (51 and 39 taxa respectively) with only 12 taxa identified by both genes. We found no significant difference between the 16S-identified diets of puffin adults (n=17) and chicks (n=41). Our molecular method is more taxonomically resolved and detected chick prey at higher frequencies than conventional field observations. Many likely planktonic prey of herring were detected in feces from puffin adults and chicks, highlighting the impact secondary consumption may have on the interpretation of molecular dietary analysis. This study represents the first simultaneous molecular investigation into the diet of multiple components of a food chain and highlights the utility of a multi-locus approach to diet reconstruction that is broadly applicable to food web analysis.

show abstract

Pyrosequencing of prey DNA in reptile faeces: analysis of earthworm consumption by slow worms

Cited by 70 publications

References 40 publications

The effects of pastoral intensification on the feeding interactions of generalist predators in streams

The effects of pastoral intensification on the feeding interactions of generalist predators in streams

Protocols for metagenomic DNA extraction and Illumina amplicon library preparation for faecal and swab samples

From Puffins to Plankton: A DNA-Based Analysis of a Seabird Food Chain in the Northern Gulf of Maine

Contact Info

Product

Resources

About