Pyrosequencing analysis of roof-harvested rainwater and river water used for domestic purposes in Luthengele village in the Eastern Cape Province of South Africa

Abstract

Pyrosequencing targeting the V1-V3 hypervariable of the 16S rDNA was used to investigate the bacterial diversity in river and roof-harvested rainwater (RHRW) used for potable purposes by rural households in Luthengele village in the Eastern Cape Province of South Africa. The phylum Proteobacteria dominated the data set (80.5% of all reads), while 4.2% of the reads could not be classified to any of the known phyla at a probability of 0.8 or higher (unclassified bacteria). At class level, the classes; Betaproteobacteria (50.4% of all reads), Alphaproteobacteria (16.2%), Verrucomicrobiae (6.6%), Planctomycetacia (5.7%) and Sphingobacteria (3%) dominated the data set in all the samples. Although the class Verrucomicrobiae constituted 6.6% of all sequences, 88.6% of the sequences were from the river sample where the class represented 43.7% of the observed sequences in the sample. The bacteria community structure clearly showed significant similarities between RHRW and differences with the river water control sample, suggesting different levels of contamination and environmental factors affecting the various water sources. Moreover, signatures of potential pathogens including Legionella, Acinetobacter, Pseudomonas, Clostridia, Chromobacterium, Yersinia and Serratia were detected, and the proportions of Legionella were relatively higher suggesting a potential health risk to households using RHRW. This work provides guidance for prioritizing subsequent culturable and quantitative analysis, to ensure that potentially significant pathogens are not left out of risk estimations.

Effect of postharvest practices including degreening on citrus carpoplane microbial biomes

“…Enterococcus is a large and diverse group of lactic acid bacteria inhabiting the gastrointestinal tract of a wide variety of animals and has been isolated from fresh produce, soil, water and bird faeces (Chidamba and Korsten ). The genus was present in very low abundances in the present study.…”

“…; Abdelfattah et al . ) and recently roof‐harvested rain water (Chidamba and Korsten ). We are not aware of such studies conducted to date to describe the impact of commercial postharvest treatments including fungicide drenching and degreening on the community structure of the citrus carpoplane.…”

“…Unlike classical microbiological approaches, culture-independent techniques capture a large proportion of microbes revealing a more complex dynamic community than that attained with traditional methods (Lopez-Velasco et al 2011;Abdelfattah et al 2016). Among the many culture-independent techniques, pyrosequencing is a recently developed next-generation sequencing technology that has been used to characterize microbial communities in numerous environments including the rhizosphere (Peiffer et al 2013), phyllosphere and carposphere (Bodenhausen et al 2013;Taylor et al 2014;Abdelfattah et al 2016) and recently roof-harvested rain water (Chidamba and Korsten 2015). We are not aware of such studies conducted to date to describe the impact of commercial postharvest treatments including fungicide drenching and degreening on the community structure of the citrus carpoplane.…”

Microbial quality and suitability of roof-harvested rainwater in rural villages for crop irrigation and domestic use

“…The automated process from MALDI-TOF-MS measurement to species identification occurs without user intervention (Pinto et al 2011;Chidamba & Korsten 2015b). Using default settings, the manufacturer's MALDI Biotyper 3.0 software (Bruker Daltonics, Germany) analyzed spectra of the isolates and compares it with reference spectra in the database.…”

“…The fungal internal transcribed spacer (ITS) region was amplified using primer set ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4R (TCCTCCGCTTATTGATATGC) (McHugh et al 2014). Bacterial pyrosequencing is not presented in this paper and has been presented in another paper (Chidamba & Korsten 2015b). …”