PTPH1 Dephosphorylates and Cooperates with p38γ MAPK to Increase Ras Oncogenesis through PDZ-Mediated Interaction

Hou, Song Wang; Zhi, Hui; Pohl, Nicole M.; Loesch, Mathew; Qi, Xiao Mei; Li, Rong Shan; Basir, Zainab; Chen, Guan

doi:10.1158/0008-5472.can-09-3229

Cited by 77 publications

(166 citation statements)

References 31 publications

Supporting

Mentioning

162

Contrasting

Order By: Relevance

“…Expression of p38␥ or p38␥/AGF was induced by addition of 1 g/ml of tetracycline that alone has been shown to have no effects on cell invasion or endogenous p38␥ protein expression (data not shown). The C-terminal truncated p38␥ mutants (p38␥⌬4 and p38␥⌬13) were generated by PCR and cloned into FLAG-tagged pcDNA3 vector as described (22).…”

Section: Methodsmentioning

confidence: 99%

“…Immunohistochemistry Studies of Primary Human Colon Cancer Tissues-Immunohistochemistry analyses were conducted in accordance with Institutional Review Board approval from the Medical College of Wisconsin and were performed as described previously (22,23). A rabbit anti-p38␥ (1:1200; R&D catalog no.…”

Section: Methodsmentioning

confidence: 99%

“…AF1644) and a goat anti-MMP9 (1:150; Santa Cruz Biotechnology) were used as primary antibodies. Staining results were scored by two observers (22), and a consensus score was assigned to each case, which were then analyzed for the relationship between p38␥ and MMP9 by a double-blind procedure.…”

Section: Methodsmentioning

confidence: 99%

“…p38␥ Knockdown, Transfection, Infection, and Luciferase Assays-Endogenous p38␥ was depleted by lentiviral-mediated shRNA delivery (with two separate target sequences by including a sequence from luciferase gene as a control) as described previously (22). The target sequences for individual genes are as follows: luciferase (shLuc), GTGCGTTGCTAGTACCAAC; #1shp38␥, CTCATGAAACATGAGAAGCTA; #2#1shp38␥, GAAGGAGATCATGAAGGTGAC.…”

Section: Methodsmentioning

confidence: 99%

“…We previously showed an increased p38␥ expression in primary colon cancer tissues (11,22). To demonstrate further whether hyperexpressed p38␥ couples with an increased MMP9 expression in primary colon cancer tissues, a group of specimens were analyzed by immunohistochemistry for p38␥ as well as MMP9 protein expression.…”

Section: P38␥ Controls Endogenous C-jun and Mmp9 Expression In Human mentioning

confidence: 99%

See 4 more Smart Citations

p38γ MAPK Cooperates with c-Jun in trans-Activating Matrix Metalloproteinase 9

Loesch

Zhi

Hou

et al. 2010

Journal of Biological Chemistry

Self Cite

106

View full text Add to dashboard Cite

Mitogen-activated protein kinases (MAPKs) regulate gene expression through transcription factors. However, the precise mechanisms in this critical signal event are largely unknown. Here, we show that the transcription factor c-Jun is activated by p38␥ MAPK, and the activated c-Jun then recruits p38␥ as a cofactor into the matrix metalloproteinase 9 (MMP9) promoter to induce its trans-activation and cell invasion. This signaling event was initiated by hyperexpressed p38␥ that led to increased c-Jun synthesis, MMP9 transcription, and MMP9-dependent invasion through p38␥ interacting with c-Jun. p38␥ requires phosphorylation and its C terminus to bind c-Jun, whereas both c-Jun and p38␥ are required for the trans-activation of MMP9. The active p38␥/c-Jun/MMP9 pathway also exists in human colon cancer, and there is a coupling of increased p38␥ and MMP9 expression in the primary tissues. These results reveal a new paradigm in which a MAPK acts both as an activator and a cofactor of a transcription factor to regulate gene expression leading to an invasive response. MAPKs3 (including extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38s) are critical signaling cascades that convert upstream signals into biological responses such as cell proliferation, invasion, and transformation (1). MAPKs are believed to do so by phosphorylating and activating a group of transcription factors, which through binding regulatory DNA elements lead to altered gene transcription. c-Jun is a major component of the AP-1 transcription factor downstream of MAPKs, whereas AP-1 is composed of homodimers of the Jun family or its heterodimers with another transcription factor such as c-Fos to bind the consensus DNA elements TGAg/cTCA (2). c-Jun is activated by JNK through phosphorylation at Ser-63, Ser-73, Thr-91, and Thr-93, and by ERK and p38 via increased gene expression. Activated c-Jun/ AP-1 leads to a cell type-specific biological response through integrated gene expression (1). However, the exact mechanism by which c-Jun converts a MAPK activity into a target gene expression remains mostly unknown.p38 MAPKs consist of four family members (␣, ␤, ␥, and ␦) in which p38␣ is ubiquitously present, whereas p38␥ is highly expressed in certain cancers (3). In addition to well established regulatory effects in cytokine signaling and stress response, substantial evidence suggests that the p38␣ pathway functions as a tumor suppressor (4 -8). p38␥, on the other hand, is a 43-kDa protein with an unique C-terminal motif, KETXL, that can dock with the PDZ (PSD-95/Dlg/ZO-1 homology) domain of other proteins (9, 10). In contrast to p38␣, our recent studies showed that p38␥ is induced by Ras and required for Ras transformation and invasion (11, 12), indicating its oncogenic activity. The underlying mechanisms for p38␥ involvement in Ras tumorigenesis, however, have not been established. In this report, we show that p38␥ acts both as an activator and a cofactor for c-Jun in trans-activating MMP9, a critical matrix metalloprote...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: P38␥ Controls Endogenous C-jun and Mmp9 Expression In Human mentioning

confidence: 99%

See 3 more Smart Citations

p38γ MAPK Cooperates with c-Jun in trans-Activating Matrix Metalloproteinase 9

Loesch

Zhi

Hou

et al. 2010

Journal of Biological Chemistry

Self Cite

106

View full text Add to dashboard Cite

show abstract

Targeting the non‐ATP‐binding pocket of the MAP kinase p38γ mediates a novel mechanism of cytotoxicity in cutaneous T‐cell lymphoma (CTCL)

et al. 2021

View full text Add to dashboard Cite

We describe here for the first time a lipid‐binding‐domain (LBD) in p38γ mitogen‐activated protein kinase (MAPK) involved in the response of T cells to a newly identified inhibitor, CSH71. We describe how CSH71, which binds to both the LBD and the ATP‐binding pocket of p38γ, is selectively cytotoxic to CTCL Hut78 cells but spares normal healthy peripheral blood mononuclear (PBMC) cells, and propose possible molecular mechanisms for its action. p38γ is a key player in CTCL development, and we expect that the ability to regulate its expression by specifically targeting the lipid‐binding domain will have important clinical relevance. Our findings characterize novel mechanisms of gene regulation in T lymphoma cells and validate the use of computational screening techniques to identify inhibitors for therapeutic development.

show abstract

PTPH1 immunohistochemical expression and promoter methylation in breast cancer patients from India: A retrospective study

Venkatesh

Shetty

Chakraborti

et al. 2018

Journal Cellular Physiology

View full text Add to dashboard Cite

Protein Tyrosine Phosphatase H1/Protein Tyrosine Phosphatase Non receptor Type 3 (PTPH1/PTPN3) is upregulated and/or mutated in glioma, ovarian, gastric, and colorectal cancers. Previous studies have documented that PTPH1-associated breast cancers exhibit enhanced sensitivity to tamoxifen and tyrosine kinase inhibitors through dephosphorylation of ER and epidermal growth factor receptor, respectively. Owing to the key role that PTPH1 plays as a biomarker in predicting the response of chemotherapeutic drugs and lack of studies on Indian breast cancer patients, the present study investigated PTPH1 protein expression and its relationship to clinical features, ER/PR/HER2/neu statuses, and methylation of promoter in breast cancer tissues (n = 67) among Indian population by immunohistochemistry and methylation specific polymerase chain reaction. PTPH1 expression was upregulated in 58.21% (39/67) and downregulated in the rest of tumor specimens, and it correlated with ER, PR, and HER2/neu statuses with p values of <0.0001, 0.0113, and 0.0448, respectively. Additionally, we found that the 2 kb region upstream of PTPH1 gene harbored CpG sites within, and was ubiquitously methylated in breast cancer (n = 13), colon cancer tissue (n = 1), uterine cancer tissue (n = 1), normal breast tissue (n = 1) in addition to Hela and MCF7 cell lines. In conclusion, our data showed a strong correlation of the PTPH1 status with the ER and ubiquitous nature of PTPH1 promoter methylation at specific CpG sites irrespective of cancer types and protein expression. Our findings underscore the clinical relevance of PTPH1 expression in Indian patients and warrant additional studies to explore the importance of ubiquitously methylated promoter at specific CpG sites in upstream of the PTPH1 gene.

show abstract

PTPH1 Dephosphorylates and Cooperates with p38γ MAPK to Increase Ras Oncogenesis through PDZ-Mediated Interaction

Cited by 77 publications

References 31 publications

p38γ MAPK Cooperates with c-Jun in trans-Activating Matrix Metalloproteinase 9

p38γ MAPK Cooperates with c-Jun in trans-Activating Matrix Metalloproteinase 9

Targeting the non‐ATP‐binding pocket of the MAP kinase p38γ mediates a novel mechanism of cytotoxicity in cutaneous T‐cell lymphoma (CTCL)

PTPH1 immunohistochemical expression and promoter methylation in breast cancer patients from India: A retrospective study

Contact Info

Product

Resources

About