PTEN Protein Phosphatase Activity Correlates with Control of Gene Expression and Invasion, a Tumor-Suppressing Phenotype, But Not with AKT Activity

Abstract

Abstract:The tumour suppressor, Phosphatase and Tensin homolog deleted on chromosome ten (PTEN), has a well characterised and important lipid phosphatase activity and a poorly characterised protein phosphatase activity. We show that both activities are required together for the regulation of cellular invasion and most of its largest effects on gene expression. PTEN appears to dephosphorylate itself at Thr366 and mutation of this site makes lipid phosphatase activity sufficient for the regulation of invasion. We propose that the dominant role for PTEN's protein phosphatase activity is autodephosphorylation-mediated regulation of its lipid phosphatase activity. Since the regulation of invasion and these large gene expression changes do not correlate with total cellular levels of its PtdInsP 3 substrate and AKT activity, we speculatively propose a role for localised PtdInsP 3 signalling in the PTEN-mediated regulation of the former processes. Finally, in identifying a tumour-derived PTEN mutant selectively lacking protein phosphatase activity, we show that in some circumstances these processes, and not AKT, can correlate with PTEN-mediated tumour suppression.3

Resistance to EGF receptor inhibitors in glioblastoma mediated by phosphorylation of the PTEN tumor suppressor at tyrosine 240

“…We cannot rule out the possibility, however, that a specific pool of PTEN is modified in this way and that PIP 3 levels at a particular subcellular location are regulated by PTEN tyrosine phosphorylation. In this regard, spatially restricted control of PTEN activity and the existence of discrete PIP 3 pools within the cell have been documented (40)(41)(42)(43)(44). Alternatively, it is possible that Y240 phosphorylation affects a lipid phosphatase-independent function of PTEN, such as the control of cell migration or invasion, although we have not observed evidence for this, and it is less clear as to how this would impact on EGFR TKI sensitivity in vitro.…”

Disruption of epithelial architecture caused by loss of PTEN or by oncogenic mutant p110α/PIK3CA but not by HER2 or mutant AKT1

“…PTEN C124S lacks all phosphatase activity and two further mutants selectively lack either lipid (PTEN G129E) or protein (PTEN Y138L) phosphatase activity [37,38]. PTEN C124S and PTEN G129E do not affect the PtdInsP 3 -dependent AKT kinases, whereas PTEN Y138L appears to suppress the phosphorylation and activation of AKT as efficiently as wild-type PTEN [37][38][39]. In order to test the function of different PTEN mutants in NMuMG cells we made silent mutations in the PTEN cDNA making it resistant to our PTEN-targeting shRNA mediated knockdown.…”

“…We recently showed the apparent requirement for both lipid and protein phosphatase activity within the same PTEN molecule in studies of glioma cell invasion [39]. In these glioma studies, PTEN appeared to autodephosphorylate a site in its C-terminal tail, Thr366, promoting lipid phosphatase dependent regulation of invasion [39].…”

“…In these glioma studies, PTEN appeared to autodephosphorylate a site in its C-terminal tail, Thr366, promoting lipid phosphatase dependent regulation of invasion [39]. To investigate further whether a similar role for PTEN's protein phosphatase activity and Thr366 phosphorylation might be acting in the regulation of epithelial morphology, we investigated whether mutation of Thr366 would overcome the apparent requirement for protein phosphatase activity in the ability of PTEN to support epithelial morphogenesis.…”

“…A cDNA encoding human HER2 was obtained from IMAGE/Source Biosciences and through the insertion of a linker, cloned into the lentiviral vector pHR-SIN-IRES-puro using MluIXbaI/SpeI restriction endonuclease digestion. A lentiviral vector based upon pHR-SIN and encoding human AKT1 was kindly provided by Dario Alessi and the introduction of the E17K mutation has been previously described along with the description of the lentiviral vectors encoding untagged human PTEN and its mutants [39]. 4 silent mutations that render the PTEN cDNA resistant to the PTEN targeting shRNA (both sh2 and sh3) were introduced by site directed mutatgenesis with the oligonucleotide 5 gaagaccataacccaccacagcttgagctaattaaacccttttgtgaagatc 3 and its reverse complement.…”