Protective Effect of Starch-stabilized Selenium Nanoparticles against Melamine-induced Hepato-renal Toxicity in Male Albino Rats

Abstract

Melamine and its analogues are illegally added to raise the apparent protein content in foods. The elevated concentrations of these compounds cause adverse effects in humans and animals. In this contribution, the protective effects of the synthesized starch-stabilized selenium nanoparticles (Se-NPs@starch) on melamine-induced hepato-renal toxicity have been systematically investigated. The Se-NPs@starch were characterized by X-ray photoelectron spectroscopy (XPS) analysis, energy dispersive spectroscopy (EDS) mapping analysis, TEM, and FT-IR. Starch plays a crucial role in the stabilization and dispersion of Se NPs, as noticed from the TEM and EDS investigations. Furthermore, the atomic ratio of Se distribution over the starch surface is approximately 1.67%. The current study was conducted on four groups of adult male rats, and the oral daily treatments for 28 days were as follows: group I served as control, group II received Se-NPs@starch, group III was exposed to melamine, while group IV was treated with melamine and Se-NPs@starch. The results reveal a significant alteration in the histoarchitecture of both hepatic and renal tissues induced by melamine. Furthermore, elevated liver and kidney function markers, high malondialdehyde, and increased expression levels of apoptosis-related genes besides a reduction in GSH and expression levels of antioxidant genes were observed in the melamine-exposed group. Interestingly, the administration of the Se-NPs@starch resulted in remarkable protection of rats against melamine-induced toxicity through increasing the antioxidant capacity and inhibiting oxidative damage. Collectively, this study provides affordable starch-stabilized Se-NPs with potent biological activity, making them auspicious candidates for prospective biomedical applications.

Selenium nanoparticles ameliorate lumbar disc degeneration by restoring GPX1-mediated redox homeostasis and mitochondrial function of nucleus pulposus cells

“…In order to regulate the morphology and distribution of SeNPs, starch has been employed as a natural stabilizing agent for size manipulation. The SeNPs stabilized by starch, possessing notable antioxidant properties, demonstrated signi cant e cacy in mitigating melamine-induced hepato-renal toxicity in rat models [40]. Furthermore, Ouyang et al have introduced a novel approach involving hydrogel microbead-based SeNPs, which can be customized with hyaluronic acid and encased in a protective calcium alginate shell to circumvent the acidic conditions of the stomach.…”

Ameliorative effect of N‐acetylcysteine on the testicular tissue of adult male albino rats after glyphosate‐based herbicide exposure

“…Subsequently, 2 µg of isolated total RNA was reverse‐transcribed into complementary DNA. The primer pairs of Bax forward: ACCAAGCTGAGCGAGG, reverse: CCAGTTGAAGTTGCCGTCTG, [ 37 ] Cytc forward: TACCCTCTCAACGACAGCAG, reverse: TCTTGACATTCTCCTCGGTG, [ 38 ] and NRF2 gene sense primer: 5′‐GGCCCTCAATAGTGCTCAG‐3′; antisense primer: 5′‐TAGGCACCTGTGGCAGATTC‐3′ [ 39 ] were used for qRT‐PCR analysis. SYBR Green PCR Master Mix was used for RT‐PCR analysis.…”