Promoter Elements of vav Drive Transgene Expression In Vivo Throughout the Hematopoietic Compartment

Abstract

To develop a method for targeting expression of genes to the full hematopoietic system, we have used transgenic mice to explore the transcriptional regulation of the vav gene, which is expressed throughout this compartment but rarely outside it. Previously, we showed that a cluster of elements surrounding its promoter could drive hematopoietic-specific expression of a bacterial lacZ reporter gene, but the expression was confined to lymphocytes and was sporadically silenced. Those limitations are ascribed here to the prokaryotic reporter gene. With a human CD4 (hCD4) cell surface reporter, the vav promoter elements drove expression efficiently and stably in virtually all nucleated cells of adult hematopoietic tissues but not notably in nonhematopoietic cell types. In multiple lines, hCD4 appeared on most, if not all, B and T lymphocytes, granulocytes, monocytes, megakaryocytes, eosinophils, and nucleated erythroid cells. Moreover, high levels appeared on both lineage-committed progenitors and the more primitive preprogenitors. In the fetus, expression was evident in erythroid cells of the definitive but not the primitive type. These results indicate that a prokaryotic sequence can inactivate a transcription unit and that the vavpromoter region constitutes a potent transgenic vector for the entire definitive hematopoietic compartment.

Cellular‐FLIP, Raji isoform (c‐FLIPR) modulates cell death induction upon T‐cell activation and infection

“…To further analyze whether murine c‐FLIP R is indeed the functional counterpart of human c‐FLIP S in the immune system, we generated a mouse model overexpressing c‐FLIP R under the control of the vav ‐promoter, which has been described to induce expression in all hematopoietic cells . As expected, thymocytes, peripheral T cells and B cells from vavFLIP R mice were protected against CD95‐mediated apoptosis when induced by CD95L or by agonistic antibodies, but were sensitive to Dex‐induced cell death, which depends on the intrinsic, that is, mitochondrial, apoptosis pathway.…”

“…To address these questions, we analyzed endogenous c‐FLIP protein expression and show that murine c‐FLIP R is induced during T‐cell activation in a similar way as we previously reported for c‐FLIP S in the human system . Moreover, we generated vavFLIP R mice expressing a c‐FLIP R transgene under the control of the vav ‐promoter leading to expression in all hemato‐poietic cells . vavFLIP R mice had normal numbers and frequencies of immune cells in the steady state.…”

“…c‐FLIP R cDNA was cloned into the vector HS21/45 vav‐ hCD4 using the Sfi I and Not I (New England Biolabs, Ipswich, MA, USA) restriction sites. The transgenic construct was injected into B6C3F1 zygotes and positive mice were identified via PCR on tail biopsies with following primers specific for the SV40 poly A sequence: c‐FLIP forward 5′‐GCCTGAAGAACATCCACAGAATAG‐3′, Poly A reverse 5′‐CTCATCAATGTATCTTATCATGTC‐3′.…”

The role of apoptosis in megakaryocytes and platelets

“…However, the identification of thrombopoietin (TPO) and development of primary megakaryocyte culture systems led to the observation that peak platelet production by mature megakaryocytes ‘corresponded to the onset of apoptosis’ (Zauli et al , ). When mice lacking the pro‐death BH3‐only protein BIM (Bouillet et al , ), or overexpressing pro‐survival BCL2 were found to be thrombocytopenic, the idea that megakaryocytes might undergo apoptosis deliberately in order to facilitate platelet shedding was born (Ogilvy et al , ).…”

Rare mutations provide unique insight into oncogenic potential of STAT transcription factors

“…Next, Pham et al (18) used the Vav1 oncogene promoter system first described by Ogilvy et al (19) to preferentially express either WT STAT5B or mutant STAT5B N642H in the hematopoietic compartment. They found that transgenic mice expressing human STAT5B N642H developed aggressive T cell leukemia/lymphoma (TLL) characterized by persistent tyrosine phosphorylation, increased numbers of myeloid progenitor cells, splenomegaly, and increased WBC counts, including expansion of CD8 + T cells.…”