Progressive Hearing Loss in Mice Carrying a Mutation inUsp53

Abstract

Disordered protein ubiquitination has been linked to neurodegenerative disease, yet its role in inner ear homeostasis and hearing loss is essentially unknown. Here we show that progressive hearing loss in the ethylnitrosourea-generated mambo mouse line is caused by a mutation in Usp53, a member of the deubiquitinating enzyme family. USP53 contains a catalytically inactive ubiquitin-specific protease domain and is expressed in cochlear hair cells and a subset of supporting cells. Although hair cell differentiation is unaffected in mambo mice, outer hair cells degenerate rapidly after the first postnatal week. USP53 colocalizes and interacts with the tight junction scaffolding proteins TJP1 and TJP2 in polarized epithelial cells, suggesting that USP53 is part of the tight junction complex. The barrier properties of tight junctions of the stria vascularis appeared intact in a biotin tracer assay, but the endocochlear potential is reduced in adult mambo mice. Hair cell degeneration in mambo mice precedes endocochlear potential decline and is rescued in cochlear organotypic cultures in low potassium milieu, indicating that hair cell loss is triggered by extracellular factors. Remarkably, heterozygous mambo mice show increased susceptibility to noise injury at high frequencies. We conclude that USP53 is a novel tight junction-associated protein that is essential for the survival of auditory hair cells and normal hearing in mice, possibly by modulating the barrier properties and mechanical stability of tight junctions.

QTL Mapping of Endocochlear Potential Differences between C57BL/6J and BALB/cJ mice

“…In the case of claudins-9 and -14, in vitro recordings have shown that the junctions become leaky, likely allowing K + to enter the organ of Corti and potentially killing hair cells through K + toxicity. There is little evidence, however, tying compromised tight junctional proteins within the reticular lamina to EP reduction (but see Kazmierczak et al 2015). The EP appears to be sensitive only to large changes in the ion-tightness of the reticular lamina, or to overt tears as may be caused by more intense noise than we applied (Salt and Konishi 1979;Melichar et al 1980;Hirose and Liberman 2003).…”

Conditional deletion of pejvakin in adult outer hair cells causes progressive hearing loss in mice

“…HEK293 cells were transiently transfected using X-tremeGENE 9 DNA transfection reagent (Roche) according to the manufacturer’s instructions. Cell lysis, immunoprecipitations with anti-GFP antibody (rabbit, Sigma) or anti-Flag antibody (mouse, Sigma) and Western blot analysis were carried out as described (Kazmierczak et al, 2015), except that cellular extracts were prepared in 50 mM TrisHCl, pH 7.6, 150 mM NaCl, 1% NP-40 and immunocomplexes washed three times in 50 mM TrisHCl, pH 7.6, 150 mM NaCl, and 0.25% NP-40. The blots were probed with anti-GFP (rabbit, Sigma), anti-Flag (mouse, Sigma) and anti-HA-HRP (rat, Roche) antibodies.…”

“…Reverse transcription and qPCR was performed as described previously (Kazmierczak et al, 2015). Primers recognizing Pgk1 were: forward, 5′-CAACAACATGGAGATTGGCACA, reverse 5′-ACAGTAGCTTGGCCAGTCTTG; and for Pjvk : forward CGGTGCCTTCGACATTTGTG, reverse 5′-GCGTCCATCACTCTCCTGTT.…”

“…Primers recognizing Pgk1 were: forward, 5′-CAACAACATGGAGATTGGCACA, reverse 5′-ACAGTAGCTTGGCCAGTCTTG; and for Pjvk : forward CGGTGCCTTCGACATTTGTG, reverse 5′-GCGTCCATCACTCTCCTGTT. No reverse transcriptase controls (no-RT controls) were included as negative controls for each sample and primer pair to assess the levels of nonspecific amplification, as described previously (Kazmierczak et al, 2015). …”

ZO‐2, a tight junction protein involved in gene expression, proliferation, apoptosis, and cell size regulation

“…These observations suggest that the disordered ubiquitination of ZO proteins might alter the barrier properties of TJs in the inner ear, leading to a loss of inner ear homeostasis and deafness. 96…”