Production of recombinant notechis 11′2L, an enzymatically active mutant of a phospholipase A₂ from Notechis scutatus scutatus venom, as directly generated by cleavage of a fusion protein produced in Escherichia coli

Abstract

We have constructed an expression vector to produce, in Escherichia coli, a fusion protein containing successively two IgG binding domains from staphyloccocal protein A, a nine‐amino‐acid linker peptide terminating in a methionine residue and the phospholipase A2 notechis 11′2L, an isoform of notexin of Notechis scutatus scutatus, venom. Notechis 11′2L is a mutant of the naturally occuring notechis 11′2 [Bouchier, C., Boyot, P., Tesson, F., Trémeau, O., Bouet, F., Hodgson, D., Boulain, J. C. & Ménez, A. (1991) Eur. J. Biochem. 202, 493–500] in which Met8 has been replaced by Leu. The fusion protein was recovered in the periplasmic extract with a yield of 0.25 mg/I culture. It was hydrolyzed with cyanogen bromide, yielding a protein having the molecular mass, amino acid composition and N‐terminal sequence of notechis 11′2L. Notechis 11′2L and the wild notechis 11′2 displayed identical circular dichroic spectra and shared similar enzymatic, myotoxic and antigenic properties, suggesting that the recombinant notechis 11′2L was directly generated in a correctly folded form.

A Recombinant Insect‐Specific α‐Toxin of Buthus occitanus tunetanus Scorpion Confers Protection Against Homologous Mammal Toxins

“…The sense oligonucleotide (5' GGGAGCG-GAGGGTACCCATGGTACGTGACGGTTATATT 3') introduced a KpnI restriction site (underlined), and a methionine residue (bold) at position -1. Since the mature sequence of BotXIV has no methionine residue, it constitutes a unique and useful CNBr-cleavage site, as previously described for other hybrid snake toxins (Ducancel et al, 1989;Boyot et al, 1990;Hodgson et al, 1993;Danse et al, 1994). The antisense oligonucleotide (S'GGGAGCGGCAGGATCCTTATCAGCGATGGCATTTT 3') was designed to introduce a BamHI restriction site and the stop codon TAA (bold), which is efficiently recognized in E. coli.…”

“…BomIII (Vargas et al, 1987) presents the highest similarity (70%) with BotXIV. The system chosen to express BotXlV in E. coli was previously demonstrated to be suited to the production of soluble, correctly folded snake venom toxins (Ducancel et al, 1989;Hodgson et al, 1993;Pillet et al, 1993;Danse et al, 1994;TrCmeau et al, 1995). This system, however, had not been used to produce recombinant scorpion toxins.…”

On the site by which α‐dendrotoxin binds to voltage‐dependent potassium channels: Site‐directed mutagenesis reveals that the lysine triplet 28–30 is not essential for binding

“…This was achieved in three steps. First, we constructed a synthetic gene encoding the published amino acid sequence of DTx from Dendroaspis angusticeps [7], expressed it at a fusion protein in E. coli according to a convenient approach which previously proved to be efficient for producing correctly folded disulfidecontaining proteins [20,21]. Second, the recombinant DTx was generated by chemical cleavage of the fusion protein and examined regarding its physicochemical and biological properties under both in vivo and in vitro conditions.…”

Expression of fully active ammodytoxin A, a potent presynaptically neurotoxic phospholipase A2, in Escherichia coli

“…Until now, PLA2s from various organisms have been produced in different expression systems including bacterial [16][17][18][19][20][21][22][23][24][25], yeast [26][27][28] and mammalian hosts [29][30][31][32][33][34]. Expression of an active PLA2 possessing 5-7 disulfide bonds in a reductive environment of the bacterial cytoplasm is practically impossible.…”

“…Expression of an active PLA2 possessing 5-7 disulfide bonds in a reductive environment of the bacterial cytoplasm is practically impossible. The only possibility to express a correctly folded PLA 2 using a bacterial system is expression into the periplasmic space which has been reported for expression of the M8L mutant of notechis 11'2 PLA2 from the elapid snake Notechis scutatus scutatus [25]; the expression yield was, however, low. In most cases, bacterial expression of PLAzs is accompanied by an in vitro refolding procedure.…”