Probing the active site of flavocytochrome b₂ by site‐directed mutagenesis

Abstract

The three-dimensional structure of flavocytochrome b2 (L-lactate dehydrogenase) from bakers' yeast (Saccharomyces cerevisiue) has recently been solved at 0.24-nm resolution in Flavins and Jlavoproteins, Walter de Gruyter, Berlin, pp. 123-1311. We have used this structural information to investigate the roles of particular amino acid residues likely to be involved in the oxidation of L-lactate by kinetic analysis of mutant enzymes generated by site-directed mutagenesis of the isolated gene.The hydroxyl group of Tyr254 was expected to be important for the abstraction of the hydroxyl proton of Llactate in the oxidation to pyruvate. Replacement of this tyrosine by phenylalanine reduced k,,, from 190 f 3 s -l (25"C, pH 7.5) to 4.3 & 0.1 s-'. This substitution had, however, no discernable effect on K, for lactate (0.54 f 0.03 mM for the mutant compared with 0.49 0.03 mM for the wild-type enzyme). Arg376 was expected to be essential for productive binding and orientation of L-lactate. Replacing Arg376 with lysine abolished all detectable activity. A total loss of enzymic activity was also observed when Lys349, thought likely to stabilize the anionic form of the flavin hydroquinone, was replaced by arginine. An amino acid residue replacement at a distance from the active site, Ala306 to serine, had a minor but significant effect on kcat (reduced from 190 s-' to 160 s-') and K,,, (increased from 0.49 mM to 0.83 mM) presumably arising from small conformational effects. The implications of these results are discussed in relation to the mechanism of L-lactate oxidation.Flavocytochrome b2 (L-lactate: cytochrome c oxidoreductase) from bakers' yeast is a tetramer of identical subunits with M , = 57500 [l]. Each subunit consists of two functionally distinct domains, one containing flavin mononucleotide (FMN), the other a protoheme IX group [2]. The protein is a soluble component of the mitochondria1 intermembrane space [3] where it catalyzes the oxidation of Llactate to pyruvate and transfers electrons directly to cytochrome c [2]. The crystal structure of flavocytochrome h2 has been solved [4, 51 allowing identification of the substrate binding site adjacent to the flavin. The structural information can be correlated with mechanistic models resulting from studies carried out in solution. It is thus possible to propose the following roles for various active-site residues (see also [a : a) Arg376 and Tyr143 bind and orient the substrate through electrostatic and hydrogen-bond interactions with the carboxylate group. b) His373 acts as a general base, abstracting the C, hydrogen as a proton resulting in carbanion formation [7]. c) Tyr254 also acts as a general base, deprotonating the substrate hydroxyl and thus facilitating electron transfer from the carbanion to the flavin. d) Lys349 facilitates electron transfer by stabilizing the N1 anion of the reduced flavin. e) Ala306 is located some distance from the active site for lactate oxidation within a disordered loop region. The mobility of this region appears to be important fo...

Interaction of two arginine residues in lactate oxidase with the enzyme flavin: Conversion of FMN to 8-formyl-FMN

“…Similar mutations have been carried out with lactate monooxygenase (25,26), mandelate dehydrogenase (27), and flavocytochrome b 2 (6,28). In each case, it is clear that the pairs of arginine residues are involved in substrate binding and catalysis.…”

Three‐dimensional structures of glycolate oxidase with bound active‐site inhibitors

“…Arg 257 has been studied in flavocytochrome b2, where replacing the homologous Arg 376 with lysine completely abolishes activity (Reid et al, 1988).…”

Strategic manipulation of the substrate specificity of Saccharomyces cerevisiae flavocytochrome b2

“…Site-directed mutagenesis was performed by the Kunkel method of non-phenotypical selection [6] using the oligonucleotides 347N (CTGCTAACAGGTTTGTGTAAAC) and 346N (GATATCT-ACTGCTGCTTCATGT) for the A198G and L230A mutations respectively and the single-stranded plasmid, pGR401 [7], as template. A double mutant was also constructed using both oligonucleotides listed above.…”