Pro-apoptotic effects of splice-switching oligonucleotides targeting Bcl-x pre-mRNA in human glioma cell lines

Abstract

Abstract. Alternative splicing is a near-ubiquitous phenomenon with important roles in human diseases, including cancers. Splice-switching oligonucleotides (SSOs) have emerged as a class of antisense therapeutics that modulate alternative splicing by hybridizing to the pre-mRNA splice site. The Bcl-x gene is alternatively spliced to express anti-apoptotic Bcl-xL and pro-apoptotic Bcl-xS. Bcl-xL expression is upregulated in many cancers and is considered a general mechanism by which cancer cells evade apoptosis. By redirecting Bcl-x pre-mRNA splicing from Bcl-xL to Bcl-xS, SSO exerted pro-apoptotic and chemosensitizing effects in various cancer cell lines. In this study, we investigated the effects of SSO targeting Bcl-x premRNA in human glioma cell lines. First, we performed reverse transcription-polymerase chain reaction (RT-PCR) and western blotting to determine the mRNA and protein expression levels of Bcl-xL in glioma cell lines (U87 and U251) and a normal human astrocyte cell line (HA1800). Then, the Bcl-x SSO was designed to bind to the downstream 5' alternative splice site of exon 2 in Bcl-x pre-mRNA and was modified using 2'-O-methoxyethyl-phosphorothioate. An oligonucleotide targeting aberrantly spliced human β-globin intron was used as a negative control. The SSOs were delivered with a cationic lipid into glioma and astrocyte cell lines. The antitumor effects of the SSOs were assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays and flow cytometry, and the switch in production from Bcl-xL to Bcl-xS was analyzed by RT-PCR and western blotting. Bcl-xL mRNA and protein were highly expressed in both glioma cell lines. The Bcl-x SSO modified Bcl-x pre-mRNA splicing and had pro-apoptotic effects on the glioma cell lines. By contrast, the lipid alone and the control SSO did not affect Bcl-xL expression or induce apoptosis. Our study demonstrated the antitumor activity of an SSO that targets Bcl-x pre-mRNA splicing in glioma cell lines. Bcl-x SSO may be a potential strategy for treating gliomas. IntroductionAlternative splicing is the process by which splice sites in precursor messenger RNA (pre-mRNA) are differentially selected and paired to produce multiple mature mRNAs and protein isoforms with distinct structural and functional properties. Alternative splicing is a very accurate, efficient, and extraordinarily flexible process that regulates many major aspects of eukaryotic cell biology. Approximately 95% of human genes with multiple exons undergo alternative splicing during pre-mRNA maturation (1-3). In addition to its role in human proteome diversity, alternative splicing is now accepted to play important roles in human diseases, including diabetes, neurodegenerative diseases, and cancer (4-6).Aberrant alternative splicing has two major roles in cancer by promoting the emergence of a cancer-specific isoform or disturbing the balanced expression of normally expressed isoforms in cancer cells (7). During tumor growth and development, and during oncogenesis, cells progress through ...

Alternative‐splicing defects in cancer: Splicing regulators and their downstream targets, guiding the way to novel cancer therapeutics

“…Increased expression of BCL‐xL and decreased expression of BCL‐xS are detected in lymphoma, glioma, myeloma, and neuroblastoma cell lines and primary tumors (Dole et al, ; Li et al, ; Tu et al, ; Xerri et al, ). Expression of the proapoptotic BCL‐xS isoform in cancer cell lines decreases cell viability and sensitizes cells to chemotherapy and radiation (Li, Li, et al, ; Mercatante, Bortner, Cidlowski, & Kole, ; Taylor, Zhang, Wyatt, & Dean, ). Conversely, expression of BCL‐xL promotes cell survival and increases resistance to apoptosis following chemotherapy (Coluccia et al, ; Dole et al, ; Hayward et al, ; Lebedeva, Rando, Ojwang, Cossum, & Stein, ).…”

Differential Impacts of Alternative Splicing Networks on Apoptosis

“…For example, overexpression of the RBM4 protein mediates relatively high levels of Bcl-x S transcripts, leading to processing of procaspase-3 and poly(ADP ribose) polymerase (PARP) which function as apoptotic markers [95]. In addition to a splicing regulator, the presence of a splice-switching oligonucleotide (SSO) was also demonstrated to reprogram Bcl-x splicing from Bcl-x L to Bcl-x S and subsequently induce apoptosis of human hepatic stellate cells [96]. The antisense oligonucleotide may function as a better therapeutic Bcl-x SSO than other apoptotic inducers that can only focus on splicing mechanisms [96].…”

“…In addition to a splicing regulator, the presence of a splice-switching oligonucleotide (SSO) was also demonstrated to reprogram Bcl-x splicing from Bcl-x L to Bcl-x S and subsequently induce apoptosis of human hepatic stellate cells [96]. The antisense oligonucleotide may function as a better therapeutic Bcl-x SSO than other apoptotic inducers that can only focus on splicing mechanisms [96]. …”

Dual genome-wide CRISPR knockout and CRISPR activation screens identify common mechanisms that regulate the resistance to multiple ATR inhibitors

“…ACTGAAGAGTGAGCCCAGCAGA) 38 , BCLX-s/l set 2 (for: GAGGCAGGCGACGAGTTTGAA; rev: TGGGAGGGTAGAGTGGATGGT) 39 . The PCR cycled as follows: 95°C for 2min to start, followed by 95°C for 30sec, 45°C for 1min, and 68°C for 1min (cycled 30 times), with a final 5minute incubation at 68°C.…”