Primary ciliary dyskinesia: a genome-wide linkage analysis reveals extensive locus heterogeneity

Blouin, Jean‐Louis; Meeks, Maggie; Radhakrishna, Uppala; Sainsbury, A.; Gehring, Chris; Saïl, Geneviève Duriaux; Bartoloni, Lucia; Dombi,; O'Rawe, Angela M.; Walne, Amanda J.; Chung, Eddie M.K.; Afzelius, Björn A.; Armengot, M; Jorissen, Mark; Schidlow, Daniel V.; Maldergem, Lionel Van; Walt, Heinrich; Gardiner, R. M.; Probst, Daniela; Guerne, Pierre‐André; DeLozier-Blanchet, C. D.; Antonarakis, Stylianos E.

doi:10.1038/sj.ejhg.5200429

Cited by 130 publications

(99 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…We have collected more than 60 well--characterized families with PCD, 31 of which have at least two affected individuals (Blouin et al, 2000). The genotypes of the DNAH9 intron 26 polymorphic locus were analyzed using touchdown PCR and primers SEA5058 (AGATCAACAGAGGCTCTGTC) and SEA5059 (TCC--ACTGGTACCGTCTCATG); the amplification product was approximately 200 bp.…”

Section: Methodsmentioning

confidence: 99%

“…This supports the hypothesis that one or more mutant dynein genes may be involved in this phenotype. Genetic heterogeneity of PCD, previously proposed because of the complex architecture of cilia, has been demonstrated through linkage studies (Blouin et al, 2000;Witt et al, 1999;Meeks et al, 2000). Recently, mutations were found in an intermediate chain dynein gene, DNAI1, in one patient with PCD (Pennarun et al, 1999).…”

Section: Introductionmentioning

confidence: 95%

“…In addition, there was no strong evidence for linkage on chromosome 17p12, the mapping position of DNAH9 (Blouin et al, 2000). However, given the extensive genetic heterogeneity of PCD, we performed mutational analysis of the entire coding region and the intron-exon junctions in 2 families in which affected individuals have concordant inheritance of alleles for a (CA) n --(GA) n microsatellite within intron 26 of DNAH9.…”

Section: Mutational Analysis Of Candidate Pcd Familiesmentioning

confidence: 99%

“…It appears that in Kartagener syndrome, organ orientation is a random rather than a predetermined event (Afzelius, 1999). Monozygotic twins have been reported with situs inversus in one twin and normal visceral orientation in the second (Noone et al, 1999;Blouin et al, 2000). The most frequent ultrastructural ciliary defect, present in more than 50% of PCD patients, is the absence of outer and/or inner dynein arms (Afzelius, 1981).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Axonemal Beta Heavy Chain Dynein DNAH9: cDNA Sequence, Genomic Structure, and Investigation of Its Role in Primary Ciliary Dyskinesia

et al. 2001

View full text Add to dashboard Cite

Dyneins are multisubunit protein complexes that couple ATPase activity with conformational changes. They are involved in the cytoplasmatic movement of organelles (cytoplasmic dyneins) and the bending of cilia and flagella (axonemal dyneins). Here we present the first complete cDNA and genomic sequences of a human axonemal dynein beta heavy chain gene, DNAH9, which maps to 17p12. The 14--kb--long cDNA is divided into 69 exons spread over 390 kb. The cDNA sequence of DNAH9 was determined using a combination of methods including 5' rapid amplification of cDNA ends, RT--PCR, and cDNA library screening. RT--PCR using nasal epithelium and testis RNA revealed several alternatively spliced transcripts. The genomic structure was determined using three overlapping BACs sequenced by the Whitehead Institute/MIT Center for Genome Research. The predicted protein, of 4486 amino acids, is highly homologous to sea urchin axonemal beta heavy chain dyneins (67% identity). It consists of an N--terminal stem and a globular C--terminus containing the four P--loops that constitute the motor domain. Lack of proper ciliary and flagellar movement characterizes primary ciliary dyskinesia (PCD), a genetically heterogeneous autosomal recessive disorder with respiratory tract infections, bronchiectasis, male subfertility, and, in 50% of cases, situs inversus (Kartagener syndrome, KS). Dyneins are excellent candidate genes for PCD and KS because in over 50% of cases the ultrastructural defects of cilia are related to the dynein complex. Genotype analysis was performed in 31 PCD families with two or more affected siblings using a highly informative dinucleotide polymorphism located in intron 26 of DNAH9. Two families with concordant inheritance of DNAH9 alleles in affected individuals were observed. A mutation search was performed in these two "candidate families," but only polymorphic variants were found. In the absence of pathogenic mutations, the DNAH9 gene has been excluded as being responsible for autosomal recessive PCD in these families.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 95%

Section: Mutational Analysis Of Candidate Pcd Familiesmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Axonemal Beta Heavy Chain Dynein DNAH9: cDNA Sequence, Genomic Structure, and Investigation of Its Role in Primary Ciliary Dyskinesia

et al. 2001

View full text Add to dashboard Cite

show abstract

“…A total-genome scan performed in 31 multiplex families did not reveal any predominant locus, rather it showed several peaks with suggestive and indicative LOD scores. 15 Another genome scan, performed in five families of Arabic origin and with reported consanguinity, revealed linkage with chromosome 19q13.3 in only three of the families, thus confirming locus heterogeneity. 16 Two additional loci, on 16p12 and 15q, were indicated by studies on genetically isolated, but heterogeneous, populations from the Faroe Islands and the Israeli Druze.…”

Section: Introductionmentioning

confidence: 98%

Sequence analysis of 21 genes located in the Kartagener syndrome linkage region on chromosome 15q

et al. 2008

View full text Add to dashboard Cite

Primary ciliary dyskinesia (PCD) is a rare genetic disorder, which shows extensive genetic heterogeneity and is mostly inherited in an autosomal recessive fashion. There are four genes with a proven pathogenetic role in PCD. DNAH5 and DNAI1 are involved in 28 and 10% of PCD cases, respectively, while two other genes, DNAH11 and TXNDC3, have been identified as causal in one PCD family each. We have previously identified a 3.5 cM (2.82 Mb) region on chromosome 15q linked to Kartagener syndrome (KS), a subtype of PCD characterized by the randomization of body organ positioning. We have now refined the KS candidate region to a 1.8 Mb segment containing 18 known genes. The coding regions of these genes and three neighboring genes were subjected to sequence analysis in seven KS probands, and we were able to identify 60 single nucleotide sequence variants, 35 of which resided in mRNA coding sequences. However, none of the variations alone could explain the occurrence of the disease in these patients.

show abstract

References

2003

The Natural and Modifed History of Congenital Heart Disease

View full text Add to dashboard Cite

Primary ciliary dyskinesia: a genome-wide linkage analysis reveals extensive locus heterogeneity

Cited by 130 publications

References 48 publications

Axonemal Beta Heavy Chain Dynein DNAH9: cDNA Sequence, Genomic Structure, and Investigation of Its Role in Primary Ciliary Dyskinesia

Axonemal Beta Heavy Chain Dynein DNAH9: cDNA Sequence, Genomic Structure, and Investigation of Its Role in Primary Ciliary Dyskinesia

Sequence analysis of 21 genes located in the Kartagener syndrome linkage region on chromosome 15q

References

Contact Info

Product

Resources

About