Prevalence of Human Noroviruses in Commercial Food Establishment Bathrooms

Abstract

Although transmission of human norovirus in food establishments is commonly attributed to consumption of contaminated food, transmission via contaminated environmental surfaces, such as those in bathrooms, may also play a role. Our aim was to determine the prevalence of human norovirus on bathroom surfaces in commercial food establishments in New Jersey, Ohio, and South Carolina under nonoutbreak conditions and to determine characteristics associated with the presence of human norovirus. Food establishments (751) were randomly selected from nine counties in each state. Four surfaces (underside of toilet seat, flush handle of toilet, inner door handle of stall or outer door, and sink faucet handle) were swabbed in male and female bathrooms using premoistened macrofoam swabs. A checklist was used to collect information about the characteristics, materials, and mechanisms of objects in bathrooms. In total, 61 (1.5%) of 4,163 swabs tested were presumptively positive for human norovirus, 9 of which were confirmed by sequencing. Some factors associated with the presence of human norovirus included being from South Carolina (odd ratio [OR], 2.4; 95% confidence interval [CI], 1.2 to 4.9; P < 0.05) or New Jersey (OR, 1.7; 95% CI, 0.9 to 3.3; 0.05 < P < 0.10), being a chain establishment (OR, 1.9; 95% CI, 1.1 to 3.3; P < 0.05), being a unisex bathroom (versus male: OR, 2.0; 95% CI, 0.9 to 4.1; 0.05 < P < 0.10; versus female: OR, 2.6; 95% CI, 1.2 to 5.7; P < 0.05), having a touchless outer door handle (OR, 3.3; 95% CI, 0.79 to 13.63; 0.05 < P < 0.10), and having an automatic flush toilet (OR, 2.5, 95% CI, 1.1 to 5.3; 0.05 < P < 0.10). Our findings confirm that the presence of human norovirus on bathroom surfaces in commercial food establishments under nonoutbreak conditions is a rare event. Therefore, routine environmental monitoring for human norovirus contamination during nonoutbreak periods is not an efficient method of monitoring norovirus infection risk.

CrAssphage as a Novel Tool to Detect Human Fecal Contamination on Environmental Surfaces and Hands

“…Over the past few decades, several viruses (e.g., human polyomavirus, Aichi virus, norovirus, and human adenovirus) have been studied as human fecal indicators for the detection of sewage-contaminated source and drinking water ( 10 – 13 ). Recently, both norovirus and adenovirus have been suggested as potential biomarkers of viral contamination to assess hygiene status and potential human health risk of contaminated surfaces and hands of affected persons ( 4 , 12 , 14 – 17 ). However, the detection of those viruses in indoor environments was relatively rare and inconsistent, making it difficult to estimate indoor hygiene and limiting their applicability for use in both industrial and regulatory settings ( 12 , 14 – 17 ).…”

Efficacy of novel aqueous photo‐chlorine dioxide against a human norovirus surrogate, bacteriophage MS2 and Clostridium difficile endospores, in suspension, on stainless steel and under greenhouse conditions

“…Bacteriophage MS2 (ATCC 15597‐B1) was propagated using Escherichia coli F amp (Migula) (ATCC 25922), as previously described (Leone et al . 2018). MS2 phage was partially purified from infected cell lysate by recovering the resulting supernatant after moderate‐speed centrifugation (5000 g , 5 min, 4°C).…”

“…Forward and reverse primer sequences for MS2 RT‐qPCR analysis were TGGCACTACCCCTCTCCGTATTCACG and GTACGGGCGACCCCACGATGAC, respectively (Leone et al . 2018). The MS2 phage standard curve was prepared by performing a seven‐step 10‐fold dilution of virus stocks.…”

Recovery of Infectious Human Norovirus GII.4 Sydney From Fomites via Replication in Human Intestinal Enteroids

“…There is evidence that fomites can initiate HuNoV outbreaks as well as lead to longer, more severe outbreaks ( Weber et al., 2010 ; Lopman et al., 2012 ; Repp and Keene, 2012 ; Canales et al., 2019 ). Swabbing of fomites is an important approach to elucidating exposure patterns ( Boxman et al., 2011 ; Morter et al., 2011 ; Ronnqvist et al., 2013 ; Keeratipibul et al., 2017 ; Leone et al., 2018 ). Historically HuNoVs recovered from fomites have been detected by recovery of viral RNA with subsequent detection by reverse transcription-quantitative PCR (RT-qPCR) ( Atmar and Estes, 2006 ; Knight et al., 2013 ).…”

“…Swabbing is required to recover HuNoV from fomites and is used extensively in HuNoV outbreak investigations ( Jones et al., 2007 ; Boxman et al., 2009 ). Additionally, fomite swabbing is used to identify environmental HuNoV contamination outside of outbreaks as a means to prevent transmission, monitor control efforts, and understand epidemiologic trends ( Boxman et al., 2011 ; Morter et al., 2011 ; Ronnqvist et al., 2013 ; Keeratipibul et al., 2017 ; Leone et al., 2018 ). Swabs collected from the environment also contribute significantly to the knowledge base necessary to conduct HuNoV risk assessments ( Ryan et al., 2014 ; Weir et al., 2016 ; Wilson et al., 2018 ).…”