Prevalence of Hb S (<i>HHB</i>: c.20A &gt; T) in a Honduran Population of African Descent

Erazo, Brian M.; Ramírez, Gilberto A.; Cerrato, Linda E.; Pinto, Luis J.; Castro, Edder J.; Yanez, Néstor J.; Montoya, Brayan D.; Fontecha, Gustavo

doi:10.3109/03630269.2015.1012294

Cited by 5 publications

(5 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A previous report indicates that more than 23% of the Afro-descendant population living in malaria endemic areas in Honduras presents the sickle-cell trait, and an overall prevalence of anaemia of 47% in 2014 [ 21 ]. Even though no association between the sickle cell trait and anaemia was observed then [ 21 ], patients were analysed in search of β S alleles. These findings seem to rule out the influence of sickle cell disease as a contributor to mild anaemia in this study, since only 2 patients were heterozygous for β S .…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

G6PD deficiency, primaquine treatment, and risk of haemolysis in malaria-infected patients

Ávalos

Mejía²,

Banegas³

et al. 2018

Malar J

View full text Add to dashboard Cite

BackgroundThe incidence of malaria in the Americas has decreased markedly in recent years. Honduras and the other countries of Mesoamerica and the island of Hispaniola have set the goal of eliminating native malaria by the year 2020. To achieve this goal, Honduras has recently approved national regulations to expand the possibilities of a shortened double dose primaquine (PQ) treatment for vivax malaria. Considering this new shortened anti-malarial treatment, the high frequency of G6PDd genotypes in Honduras, and the lack of routinely assessment of the G6PD deficiency status, this study aimed at investigating the potential association between the intake of PQ and haemolysis in malaria-infected G6PDd subjects.MethodsThis was a prospective cohort and open-label study. Participants with malaria were recruited. Plasmodium vivax infection was treated with 0.25 mg/kg of PQ daily for 14 days. Safety and signs of haemolysis were evaluated by clinical criteria and laboratory values before and during the 3rd and 7th day of PQ treatment. G6PD status was assessed by a rapid test (CareStart™) and two molecular approaches.ResultsOverall 55 participants were enrolled. The frequency of G6PD deficient genotypes was 7/55 (12.7%), where 5/7 (71.4%) were hemizygous A− males and 2/7 (28.6%) heterozygous A− females. Haemoglobin concentrations were compared between G6PD wild type (B) and G6PDd A− subjects, showing a significant difference between the means of both groups in the 3rd and 7th days. Furthermore, a statistically significant difference was evident in the change in haemoglobin concentration between the 3rd day and the 1st day for both genotypes, but there was no statistical difference for the change in haemoglobin concentration between the 7th day and the 1st day. Besides these changes in the haemoglobin concentrations, none of the patients showed signs or symptoms associated with severe haemolysis, and none needed to be admitted to a hospital for further medical attention.ConclusionsThe findings support that the intake of PQ during 14 days of treatment against vivax malaria is safe in patients with a class III variant of G6PDd. In view of the new national regulations in the shortened treatment of vivax malaria for 7 days, it is advisable to be alert of potential cases of severe haemolysis that could occur among G6PD deficient hemizygous males with a class II mutation such as the Santamaria variant, previously reported in the country.Electronic supplementary materialThe online version of this article (10.1186/s12936-018-2564-2) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionmentioning

confidence: 99%

“…Additionally, a genetic analysis of the β-globin gene was also performed to reveal the presence of the sickle cell trait (β S ) among the studied population. A PCR–RFLP approach was conducted according to previous reports [ 20 , 21 ].…”

Section: Methodsmentioning

confidence: 99%

G6PD deficiency, primaquine treatment, and risk of haemolysis in malaria-infected patients

Ávalos

Mejía²,

Banegas³

et al. 2018

Malar J

View full text Add to dashboard Cite

show abstract

“…In order to ensure the integrity of DNA and an absence of the inhibitors from the clinical samples, a region of the human beta-globin gene was amplified as previously described [25] using the primers PCO3: 5 -ACA CAA CTG TGT TTC ACT AGC-3 and PCO5: 5 -GAA ACC CAA GAG TCT TCT CT-3 .…”

Section: Pcr-rflpmentioning

confidence: 99%

Identification of Candida Species from Clinical Samples in a Honduran Tertiary Hospital

et al. 2019

View full text Add to dashboard Cite

Candida species are one of the most important causes of human infections, especially in hospitals and among immunocompromised patients. The correct and rapid etiological identification of yeast infections is important to provide adequate therapy, reduce mortality, and control outbreaks. In this study, Candida species were identified in patients with suspected fungal infection, and phenotypic and genotypic identification methods were compared. A total of 167 axenic fungal cultures and 46 clinical samples were analyzed by HardyCHROM®, MicroScan®(Omron Microscan Systems Inc, Renton, WA, USA), and PCR-RFLP (Restriction Fragment Length Polymorphisms). The species of the C. albicans complex were the most frequent, followed by C. tropicalis and C. glabrata. Less common but clinically relevant species of Candida were also isolated. The comparison between the three methods was concordant, especially for the most common Candida species. Fungal DNA amplification was successful in all clinical samples.

show abstract

“…The gel was read on BioDoc–It Imaging System (CA, USA). Purity of DNA was verified by amplifying the human beta–globin gene 60 using the primers PCO3: 5’–ACACAACTGTGTTTCACTAGC–3’ and PCO5: 5’–GAAACCCAAGAGTCTTCTCT–3’.…”

Section: Methodsmentioning

confidence: 99%

A New Variant of Mutational and Polymorphic Signatures in the ERG11 Gene of Fluconazole-Resistant Candida albicans

Odiba¹,

Durojaye²,

Ezeonu³

et al. 2022

IDR

View full text Add to dashboard Cite

Background Resistance to antifungal drugs for treating Candida infections remains a major concern globally despite the range of medications available. Most of these drugs target key proteins essential to the life cycle of the organism. An enzyme essential for fungal cell membrane integrity, lanosterol 14–α demethylase (CYP51), is encoded by the ERG11 gene in Candida species. This enzyme is the target of azole–based drugs. The organism has, however, devised molecular adaptations to evade the activity of these drugs. Materials and Methods Classical methods were employed to characterize clinical isolates sampled from women and dogs of reproductive age. For fluconazole efficacy studies, CLSI guidelines on drug susceptibility testing were used. To understand the susceptibility pattern, various molecular and structural analytic approaches, including sequencing, in silico site-directed mutagenesis, and protein-ligand profiling, were applied to the ERG11 gene and CYP51 protein sequences. Several platforms, comprising Clustal Omega, Pymol plugin manager, Pymol molecular visualizer, Chimera–curated Dynameomics rotamer library, protein–ligand interaction profiler, Charmm36 force field, GROMACS, Geneious, and Mega7, were employed for this analysis. Results The following Candida species distribution was obtained: 37.84% C. albicans , 8.12% C. glabrata , 10.81% C. krusei , 5.41% C. tropicalis , and 37.84% of other unidentified Candida species. Two codons in the nucleotide sequence of the wild-type (CTC and CCA) coding for LEU–370 and PRO–375, respectively, were mutated to L370S and P375H in the resistant strain. The mutation stabilized the protein at the expense of the heme moiety. We found that the susceptible isolate from dogs ( Can–iso–029/dog ) is closely related to the most resistant isolate from humans. Conclusion Taken together, our results showed new mutations in the heme-binding pocket of caCYP51 that explain the resistance to fluconazole exhibited by the Candida isolates. So far, the L370S and P375H resistance-linked mutations have not been previously reported.

show abstract

Prevalence of Hb S (HHB: c.20A > T) in a Honduran Population of African Descent

Cited by 5 publications

References 19 publications

G6PD deficiency, primaquine treatment, and risk of haemolysis in malaria-infected patients

G6PD deficiency, primaquine treatment, and risk of haemolysis in malaria-infected patients

Identification of Candida Species from Clinical Samples in a Honduran Tertiary Hospital

A New Variant of Mutational and Polymorphic Signatures in the ERG11 Gene of Fluconazole-Resistant Candida albicans

Contact Info

Product

Resources

About