Prevalence and Characterization of Murine Leukemia Virus Contamination in Human Cell Lines

Abstract

Contaminations of cell cultures with microbiological organisms are well documented and can be managed in cell culture laboratories applying reliable detection, elimination and prevention strategies. However, the presence of viral contaminations in cell cultures is still a matter of debate and cannot be determined with general detection methods. In the present study we screened 577 human cell lines for the presence of murine leukemia viruses (MLV). Nineteen cell lines were found to be contaminated with MLV, including 22RV1 which is contaminated with the xenotropic murine leukemia virus-related virus variant of MLV. Of these, 17 cell lines were shown to produce active retroviruses determined by product enhanced reverse transcriptase PCR assay for reverse transcriptase activity. The contaminated cell lines derive from various solid tumor types as well as from leukemia and lymphoma types. A contamination of primary human cells from healthy volunteers could not be substantiated. Sequence analyses of 17 MLV PCR products and five complete MLV genomes of different infected cell lines revealed at least three groups of related MLV genotypes. The viruses harvested from the supernatants of infected cell cultures were infectious to uninfected cell cultures. In the course of the study we found that contamination of human genomic DNA preparations with murine DNA can lead to false-positive results. Presumably, xenotransplantations of the human tumor cells into immune-deficient mice to determine the tumorigenicity of the cells are mainly responsible for the MLV contaminations. Furthermore, the use of murine feeder layer cells during the establishment of human cell lines and a cross-contamination with MLV from infected cultures might be sources of infection. A screening of cell cultures for MLV contamination is recommended given a contamination rate of 3.3%.

Disrupting MLV integrase:BET protein interaction biases integration into quiescent chromatin and delays but does not eliminate tumor activation in a MYC/Runx2 mouse model

“…Genomic DNA isolates from 293mCAT cells were analyzed for mouse DNA contamination by examining for mouse intracisternal particle A (IAP) and mouse mitochondrial cyclooxygenase-2 (mCOX2). The primers used were mouse_IAP_fwd (ATAATCTGCGCATGAGCCAA GG) and Mouse_IAP_rev (AGGAAGAACACCACAGACCAG) [90], and primers used for COX2 were Mouse_mt__COX2_fwd (5 0 TTC TAC CAG CTG TAA TCC TTA 3 0 ) and Mou-se_mt_COX2__rev (5 0 GTT TTA GGT CGT TTG TTG GGA T 3 0 ) [91]. PCR analysis was performed using KOD HotStart.…”

Differential Requirements for the RAD51 Paralogs in Genome Repair and Maintenance in Human Cells

“…Detection of EBV, HBV, HCV, HIV-1, HIV-2, HTLV-I/II, MLV, and SMRV was carried out as described previously (Uphoff et al 2010(Uphoff et al , 2015.…”

A new ALK isoform transported by extracellular vesicles confers drug resistance to melanoma cells

“…We confirmed by whole genome sequencing that this MMLV was stably inserted in our A375 cells (data not shown). The identification of MMLV has been reported for many cancer cell lines, including melanoma, across several laboratories [ 29 , 30 ] suggesting MMLV as a regular resident in cancer cells. Nevertheless, the activation of ALK by a murine retrovirus suggests that other sequences from human retroviruses or their closely related human retrotransposons or any other translocating sequence can activate this oncogene in humans.…”