Preterm infants with necrotising enterocolitis demonstrate an unbalanced gut microbiota

Abstract

Aim: This Lebanese study tested the hypothesis that differences would exist in the gut microbiota of preterm infants with and without necrotising enterocolitis (NEC), as reported in Western countries.Methods: This study compared 11 infants with NEC and 11 controls, all born at 27-35 weeks, in three neonatal intensive care units between January 2013 and March 2015. Faecal samples were collected at key time points, and microbiota was analysed by culture, quantitative PCR (qPCR) and temperature temporal gel electrophoresis (TTGE). Results:The cultures revealed that all preterm infants were poorly colonised and harboured no more than seven species. Prior to NEC diagnosis, significant differences were observed by qPCR with a higher colonisation by staphylococci (p = 0.034) and lower colonisations by enterococci (p = 0.039) and lactobacilli (p = 0.048) in the NEC group compared to the healthy controls. Throughout the study, virtually all of the infants were colonised by Enterobacteriaceae at high levels. TTGE analysis revealed no particular clusterisation, showing high interindividual variability. Conclusion:The NEC infants were poorly colonised with no more than seven species, and the controls had a more diversified and balanced gut microbiota. Understanding NEC aetiology better could lead to more effective prophylactic interventions and a reduced incidence.

Individual variations in intestinal microbiota were higher in preterm infants with necrotising enterocolitis than healthy controls

“…We confirmed our previous results, which failed to identify a unique pathogen, but showed dysbiosis in NEC infants. The gut microbiota was richer and more diversified in the controls, with a significantly higher OTU index at all sampling points ( P = .…”

“…Significant differences were observed between preterm infants with NEC and matched healthy controls. In particular, higher colonisation by staphylococci and lower colonisation by bifidobacteria were associated with a less diversified bacterial profile in the NEC group …”

“…The 11 matched control infants had no signs of enteropathy and were sampled at similar postnatal ages. After deoxyribonucleic acid extraction, as previously described, the V3‐V4 region of the 16S rRNA gene was amplified using primers F343 (CTTTCCCTACACGACGCTCTTCCGATCTTACGGRAGGCAGCAG) and R784 (GGAGTTCAGACGTGTGCTCTTCCGATCTTACCAGGGTATCTAATCCT). Amplicons were sequenced using MiSeq technology (Illumina) on GetPlaGe platform and analysed by FROGS (INRA) to produce abundance tables of operational taxonomic units (OTUs) and taxonomic affiliation.…”

Yeast fermentate prebiotic improves intestinal barrier integrity during heat stress by modulation of the gut microbiota in rats

“…and Staphylococcus spp. also specifies dysbiotic changes of the gut microbiota (Popova et al, 2017;Itani et al, 2018). The number of Lactobacillus spp.…”

Preterm infants harbour diverse Klebsiella populations, including atypical species that encode and produce an array of antimicrobial resistance- and virulence-associated factors

“…This left 14 distinct Klebsiella strains (9 K. pneumoniae; 5 K. oxytoca) for further analyses. Genome analyses of K. pneumoniae strains K. pneumoniae is a commensal of the human gut microbiota and can cause nosocomial infections, NEC and LOS in premature neonates [9,17,[48][49][50][51]. The genetic backgrounds of the neonate isolates were explored to determine virulence and the AMR genes encoded within the strains' genomes.…”