Prestress and Area Compressibility of Actin Cortices Determine the Viscoelastic Response of Living Cells

Cordes, Andrea; Witt, Hannes; Gallemí-Pérez, Aina; Brückner, Bastian Rouven; Grimm, Florian; Vache, Marian; Oswald, Tabea A.; Bodenschatz, Jonathan F. E.; Flormann, Daniel; Lautenschläger, Franziska; Tarantola, Marco; Janshoff, Andreas

doi:10.1103/physrevlett.125.068101

Cited by 37 publications

(72 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Indeed, ZO1 and ZO2 proteins were no longer visible upon double knockdown ( Figure S3). Corresponding western blot analyses can be found in Beutel et al [40] ZO1 knockout was also successful as shown in Figure S3A. Importantly, ZO2 was only slightly upregulated indicating a possible compensation for ZO1.…”

Section: Successful Zo Knockdown Induces Actomyosin Remodelingsupporting

confidence: 72%

See 1 more Smart Citation

Tight junction ZO proteins maintain tissue fluidity, ensuring efficient collective cell migration

Skamrahl

Pang

Ferle

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Tight junctions are pivotal components of epithelial tissues connecting neighboring cells to provide protective barriers. However, explicit knowledge of their role during other crucial biological processes, such as collective cell migration, remains sparse. Here, the importance of the tight junction proteins ZO1 and ZO2 for epithelial migration is investigated employing video microscopy in conjunction with velocimetry, segmentation, cell tracking, and atomic force microscopy/spectroscopy. The results indicate that ZO proteins are necessary for fast and coherent migration. In particular, ZO1 and 2 loss induces actomyosin remodeling away from the central cortex towards the periphery of individual cells, resulting in altered viscoelastic properties. A tug-of-war emerges between two cell populations with distinct morphological and mechanical properties: 1) smaller and highly contractile cells with an outwards bulged apical membrane, and 2) larger, flattened cells, which, due to tensile stress, display a higher proliferation rate. In response, the cell density increases, leading to crowding-induced jamming and more small cells over time. These smaller cells are particularly immobile and therefore drive jamming. Knockout of only ZO1 induces a similar but less pronounced behavior. This study shows that ZO proteins are necessary for efficient collective cell migration by maintaining tissue fluidity and controlling proliferation.

show abstract

Section: Successful Zo Knockdown Induces Actomyosin Remodelingsupporting

confidence: 72%

“…Genetic modification of ZO proteins: ZO knockdowns were effected as described in Beutel et al. [40] To knockdown ZO1 and ZO2 in MDCK II cells, frame-shift mutations were introduced at the N-termini by CRISPR/Cas9. The following RNA guides (gRNA) were used for ZO1: ACACACAGTGACGCTTCACA and ZO2: GTACACTGTGACCCTACAAA.…”

Section: Resultsmentioning

confidence: 99%

Tight junction ZO proteins maintain tissue fluidity, ensuring efficient collective cell migration

Skamrahl

Pang

Ferle

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…If the cortical film is subject to dynamic deformation, the mechanical response of the cortex changes over time. We assume a linear viscoelastic response of the form [22, 55] where ϵ A ( t ) = ( A ( t ) – A 0 )/ A 0 is the area strain, A 0 is a reference area, and the dot indicates a time derivative. The relaxation modulus G ( t ) shows the time-dependent response, which consists of memory effects due to viscoelastic material properties.…”

Section: Methodsmentioning

confidence: 99%

“…If the cortical film is subject to dynamic deformation, the mechanical response of the cortex changes over time. We assume a linear viscoelastic response of the form [22,53]…”

Section: Model Of Cortical Force Responsementioning

confidence: 99%

EMT changes actin cortex rheology in a cell-cycle dependent manner

Hosseini

Frenzel

Fischer‐Friedrich

2020

Preprint

View full text Add to dashboard Cite

The actin cortex is a key structure for cellular mechanics and cellular migration. Accordingly, cancer cells were shown to change their mechanical properties based on different degrees of malignancy and metastatic potential. Epithelial-Mesenchymal transition (EMT) is a cellular transformation associated with cancer progression and malignancy. To date, a detailed study of the effects of EMT on the frequency-dependent viscoelastic mechanics of the actin cortex is still lacking. In this work, we have used an established AFM-based method of cell confinement to quantify the rheology of the actin cortex of human breast, lung and prostate epithelial cells before and after EMT in a frequency range of 0.02 − 2 Hz. Interestingly, we find for all cell lines opposite EMT-induced changes in interphase and mitosis; while the actin cortex softens upon EMT in interphase, it stiffens in mitosis. Our rheological data can be accounted for by a rheological model with a characteristic time scale of slowest relaxation. In conclusion, our study discloses a consistent rheological trend induced by EMT in human cells of diverse tissue origin reflecting major structural changes of the actin cytoskeleton upon EMT.

show abstract

“…In recent decades, investigation of the filaments of the cytoskeleton, such as actin, vimentin, and microtubules, has become increasingly important for our understanding of cellular functions [1][2][3][4] . For example, the spatial organization of the cytoskeletal network has an important role in cell migration 5,6 , cancer metastasis 7,8 , and cellular mechanics 1,[9][10][11][12] . The methods used to detect and image these structures vary from low-resolution fluorescence imaging, through high-resolution fluorescent imaging, to electron microscopy 3,6,[13][14][15][16] .…”

Section: Introductionmentioning

confidence: 99%

A novel universal algorithm for filament network tracing and cytoskeleton analysis

Flormann

Schu

Terriac

et al. 2021

Preprint

View full text Add to dashboard Cite

The rapid development of advanced microscopy techniques over recent decades has significantly increased the quality of imaging and our understanding of subcellular structures, such as the organization of the filaments of the cytoskeleton using fluorescence and electron microscopy. However, these recent improvements in imaging techniques have not been matched by similar development of techniques for computational analysis of the images of filament networks that can now be obtained. Hence, for a wide range of applications, reliable computational analysis of such two-dimensional (2D) methods remains challenging. Here, we present a new algorithm for tracing of filament networks. This software can extract many important parameters from grayscale images of filament networks, including the Mesh Hole Size, and Filament Length and Connectivity (also known as Coordination Number. In addition, the method allows sub-networks to be distinguished in 2D images using intensity thresholding. We show that the algorithm can be used to analyze images of cytoskeleton networks obtained using different advanced microscopy methods. We have thus developed a new improved method for computational analysis of 2D images of filamentous networks that has wide applications for existing imaging techniques. The algorithm is available as open-source software.

show abstract

Prestress and Area Compressibility of Actin Cortices Determine the Viscoelastic Response of Living Cells

Cited by 37 publications

References 43 publications

Tight junction ZO proteins maintain tissue fluidity, ensuring efficient collective cell migration

Tight junction ZO proteins maintain tissue fluidity, ensuring efficient collective cell migration

EMT changes actin cortex rheology in a cell-cycle dependent manner

A novel universal algorithm for filament network tracing and cytoskeleton analysis

Contact Info

Product

Resources

About