Presence of ultrastructural arterial lesions in muscle and skin vessels of patients with CADASIL.

Abstract

ResponseWe are grateful to Drs Norris and Bladin for their interest in our review of the relative merits of ticlopidine and aspirin, 1 but we are not sure whether there is a baby in the bathwater at all. We feel less confident than they do that the point estimate of the overall advantage of ticlopidine over aspirin (8% with 3500 patients) would remain the same with greater numbers and would then reach statistical significance. This is what 95% confidence intervals (-4% to 19%) are all about: we simply don't know. By the way, we could not find a P of <.OO7 in the paper about the Ticlopidine Aspirin Stroke Study (nor indeed any significant difference for any outcome event that included more than stroke alone) 2 ; is this perhaps a subgroup analysis that did not survive the final stages of publication? What the report does contain is a table of side effects, totalling 62% in the ticlopidine group and 53% in the aspirin group (with 1300 mg!). These proportions have not been weighted for severity, but this uncertainty can be interpreted both ways, as it can for efficacy.

Differences in proliferation rate between CADASIL and control vascular smooth muscle cells are related to increased TGFβ expression

“…The clinical presentation of CADASIL is characterized by migraine with aura, transient neurological symptoms, mood disturbances and cognitive impairment 3, 4, 5, 6, 7. Pathological characteristics evident in the brain of patients with CADASIL include deposits of granular osmiophilic material (GOM) in close vicinity to the basement membrane that surrounds vascular smooth muscle cells (VSMCs) of parenchymal arterioles,8, 9 and degeneration of VSMCs 10, 11 in small and medium‐sized arteries 12, 13. Subsequent to VSMC degeneration, fibrotic thickening of the vessel walls and narrowing of the lumina of small penetrating arterioles occur predominantly in cerebral white matter 14.…”

Diagnosing Vascular Dementia by Skin Biopsy - Uniqueness of CADASIL

“…As a striking and pathognomonic feature of CADASIL, GOM accumulates on VSMCs (Baudrimont et al, 1993, Ruchoux et al, 1995. Already before the gene defect was found, GOM was detected in skin biopsies from CADASIL patients (Ruchoux et al, 1994). So far GOM has not been described in any other disease entity: GOM is negative in both histological (e.g.…”

Small in-frame deletions and missense mutations in CADASIL: 3D models predict misfolding of Notch3v EGF-like repeat domains

“…Probands were selected on the basis of In all families the diagnosis of CADASIL had been confirmed by biopsy (n = 66) or autopsy (n = 5). 18,19 Mutation analysis Following informed consent, genomic DNA was isolated from peripheral blood leukocytes. Exons 3 and 4 of the Notch3 gene were amplified using the following intronic primers: exon 3 (F: 5'TGTGCTGCCCAACCAAGCCA; R: 5'ACTGACCACACCCCCGACTA); exon 4 (F: 5'TAGTCGGGGGTGTGGTCAGT; R: 5'CCTCTGACTCTCCTGAGTAG).…”