Presence of paratuberculosis in dairy cows culled in Tizayuca (Hidalgo, Mexico)

Castillo-Velázquez, Uziel; Gómez-Flores, Ricardo; Gris, Gilberto Chávez; Favila-Humara, Lucía C.; Soto-Castor, Rafael; Maldonado-Castro, Edith; Tamez‐Guerra, Patricia

doi:10.17533/udea.rccp.v28n2a06

Cited by 4 publications

(3 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Based on gross post mortem examination of tissue samples in the present abattoir study, the prevalence of gross lesions resembling paratuberculosis recorded in the present study was in line with the results reported by the study conducted earlier [27]. However, the prevalence of gross lesions resembling paratuberculosis found in this study is lower than those reported previously in other countries [5, 14], while it was higher than nding reported by other authors [28,29]. The difference in the prevalence of paratuberculosis gross lesions could be due to the difference in the origin or type of production system, age of the host, immune status and breed of the animals that are slaughtered in the abattoir.…”

Section: Discussionsupporting

confidence: 92%

Prevalence and pathology of paratuberculosis in cattle slaughtered at ELFORA export abattoir Bishoftu, central Ethiopia

Mohammed

Mamo

Zewudi

et al. 2022

Preprint

View full text Add to dashboard Cite

Background Paratuberculosis, caused by Mycobacterium avium subsp. paratuberculosis (MAP), is a chronic progressive granulomatous enteritis affecting ruminants and a wide variety of domestic and wild life species worldwide. Although there are reports of clinical cases of paratuberculosis in different veterinary clinics in Ethiopia, there is no epidemiological data on this disease in Ethiopia. Thus, this study was formulated to investigate the prevalence and pathology of paratuberculosis in apparently healthy cattle slaughtered at ELFORA export abattoir. Small intestines and associated mesenteric lymph nodes of 400 cattle slaughtered at ELFORA export abattoir were examined for gross pathological lesions of paratuberculosis. The diagnosis was confirmed by histopathological examination. The microscopic lesions were then graded on the basis of the type and amount of cellular infiltrations. Results When the intestines and the corresponding lymph nodes were examined in the slaughterhouses the prevalence of paratuberculosis gross lesions was 11.25% (45/400). The gross lesions were characterized by intestinal thickening, mucosal corrugations and enlargement of associated mesenteric lymph nodes. Histopathologically 17.9% (8/45) of the cattle with gross lesion were found to have microscopic lesion compatible with paratuberculosis. The microscopic lesions were characterized by granuloma of different grades. The grading of the microscopic lesions revealed 2 animals had grade I, 4 grade II and 2 grade III lesions. Conclusions This study indicated the occurrence of paratuberculosis in cattle of Ethiopia using gross pathological examination of tissue samples. However, gross pathology alone cannot be used as a diagnostic tool and the findings stress the importance of a careful histopathological examination for confirmation of the gross lesions. We conclude that paratuberculosis is prevalent in cattle of Ethiopia for the first time and the result warrants for further nationwide study of the disease to establish its epidemiology and economic significance.

show abstract

Section: Discussionsupporting

confidence: 92%

Prevalence and pathology of paratuberculosis in cattle slaughtered at ELFORA export abattoir Bishoftu, central Ethiopia

Mohammed

Mamo

Zewudi

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…Genotype typification studies have detected Type C and its different subtypes in both red deer (Cervus elaphus) and scimitar-horned oryx [16,32]. These results agree with those in reports from Mexico, where Type C MAP has been detected in domestic bovine and caprine populations [20,23,33]. However, it is necessary to perform more extensive studies to understand the genetic diversity of MAP present in wild ruminants under human care in zoological collections, as well as in domestic ruminants in Mexico.…”

Section: Discussionsupporting

confidence: 88%

“…The P3N (5´GGGTGTGGCGTTTTCCTTCG 3´) and P5N (5´ATTTCGCCGCCACCGCCACG 3´) primers were used. These amplify a fragment of 314 bp from the IS900 insertion sequence of MAP [22,23]. For this test, 3 µL of DNA were used (equivalent to 0.5 µg), 20 µL of FastStart™ PCR Master (Roche ® , USA), and 1 µL of each primer.…”

Section: Is900 Pcrmentioning

confidence: 99%

First identification of Mycobacterium avium subsp. paratuberculosis in wild ruminants in a zoo in Mexico

et al. 2022

View full text Add to dashboard Cite

Background and Aim: Paratuberculosis (PTB) is an infectious disease that induces chronic enteritis in ruminants. It is caused by Mycobacterium avium subsp. paratuberculosis (MAP). In this study, we evaluated the presence of MAP using bacteriological, molecular, and anatomopathological studies, based on the clinical suspicion of PTB in a zoo, in an area housing 10 scimitar-horned oryx (Oryx dammah), five giraffes (Giraffa camelopardalis), and three blue wildebeests (Connochaetes taurinus). Materials and Methods: From November 2016 to June 2017, fecal samples were collected from individuals of the three species on four occasions, resulting in a total of 56 fecal samples. In addition, five small intestine samples were collected from the necropsies of three adult scimitar-horned oryx females and two oryx calves. MAP identification was performed through isolation in Herrold's medium with egg yolk, mycobactin, and sodium pyruvate, Ziehl–Neelsen staining, IS900 polymerase chain reaction (IS900 PCR), and anatomopathological examination of intestine samples. Results: Diffuse granulomatous enteritis with abundant acid-fast bacilli was found in two out of five intestine samples from adult scimitar-horned oryx females. MAP was isolated in 7/56 (12.5%) of the fecal samples from four scimitar-horned oryx, one giraffe, and two wildebeest samples. Two out of 5 (40%) samples obtained from scimitar-horned oryx tested positive. IS900 PCR yielded five positive samples (two fecal samples and three small intestine samples). MAP isolates were classified as Type C (Cattle) using type-specific PCR. Conclusion: These results demonstrated the presence of MAP in the area evaluated and indicated the importance of both sampling live animals and conducting postmortem examinations. The use of bacteriological and histopathological diagnostic techniques demonstrated in this study will provide insight into the health status and prevalence of paratuberculosis in wild ruminants under human care.

show abstract

Prevalence of paratuberculosis in cattle based on gross and microscopic lesions in Ethiopia

Mohammed,

Mamo,

Zewude

et al. 2023

BMC Vet Res

View full text Add to dashboard Cite

Background Paratuberculosis, caused by Mycobacterium avium subsp. paratuberculosis (MAP), is a chronic progressive granulomatous enteritis mainly affecting domestic and wild ruminants worldwide. Although paratuberculosis could be prevail in Ethiopia, there is a scarcity of epidemiological data on paratuberculosis in the country. Thus, this study was conducted to estimate the prevalence of paratuberculosis based on gross and microscopic lesions in cattle slaughtered at ELFORA Abattoir, central Ethiopia. Small intestines and associated lymph nodes of 400 apparently healthy cattle which were slaughtered at ELFORA export abattoir were examined for gross and microscopic lesions of paratuberculosis. The microscopic lesions were classified into four grades (I-IV) based on the type and number of cells infiltrated into the lesion. The prevalence of paratuberculosis was estimated on the basis of gross as well as microscopic lesion of paratuberculosis. Results The prevalence of paratuberculosis was 11.25% (95% Confidence interval, CI = 0.083–0.148) on the basis of gross lesion. However, relatively lower prevalence (2.0%, 95% CI = 0.01, 0.039) was recorded based on microscopic lesion. The gross lesions were characterized by intestinal thickening, mucosal corrugations and enlargement of associated mesenteric lymph nodes. On the other hand, the microscopic lesions were characterized by granuloma of different grades ranging from grade I to grade III lesions. Conclusions The present study indicated the occurrence of paratuberculosis in cattle of Ethiopia based on the detection of gross and microscopic lesions consistent with the lesion of paratuberculosis. The result of this study could be used as baseline information for future studies on the epidemiology and economic significance of paratuberculosis.

show abstract

Presence of paratuberculosis in dairy cows culled in Tizayuca (Hidalgo, Mexico)

Cited by 4 publications

References 10 publications

Prevalence and pathology of paratuberculosis in cattle slaughtered at ELFORA export abattoir Bishoftu, central Ethiopia

Prevalence and pathology of paratuberculosis in cattle slaughtered at ELFORA export abattoir Bishoftu, central Ethiopia

First identification of Mycobacterium avium subsp. paratuberculosis in wild ruminants in a zoo in Mexico

Prevalence of paratuberculosis in cattle based on gross and microscopic lesions in Ethiopia

Contact Info

Product

Resources

About