Preparation and evaluation of goose reovirus inactivated vaccine

Abstract

BackgroundInfection with Goose Reovirus (GRV) can cause serious economic losses in the goose breeding industry. In this study, the GRV allantoic fluid was concentrated and used as an antigen in a formalin-inactivated oil-emulsion vaccine.ResultsWhen 6 day-old geese were inoculated, antibodies against GRV became detectable at 6 days post-vaccination, their concentration peaked at 3 weeks. These antibodies were maintained for longer than 2 weeks. As the most susceptible age for GRV infection is birds under 2 weeks of age this vaccine should provide adequate cover for the most at risk birds. When geese were exposed to reovirus at different time intervals after immunization, the data revealed that the vaccine can provide a protection rate of 80%. The developed vaccine has good stability and could be stored at 4 °C for at least 12 months.ConclusionThese results indicate that the developed GRV vaccine is safe, effectively absorbed, efficacious in inducing a rapid immune response, and effective in controlling GRV infection. Our results should be useful for the application of vaccines for controlling GRV in different goose flocks.Electronic supplementary materialThe online version of this article (doi:10.1186/s12917-017-1134-0) contains supplementary material, which is available to authorized users.

Epidemiological investigation of H9 avian influenza virus, Newcastle disease virus, Tembusu virus, goose parvovirus and goose circovirus infection of geese in China

“…The supernatant of centrifuged tissue homogenate was frozen and thawed three times and sterilized by passing through a 0.22‐mm filter inoculated with different cell cultures for virus isolation (Table ) (Niu et al., ). The occurrence of cytopathogenic effects (CPE) was recorded after inoculation for 3–4 days.…”

Genomic and epidemiological characteristics provide insights into the phylogeographic spread of goose astrovirus in China

“…The collected tissue samples were homogenized in phosphate-buffered saline (PBS) and centrifuged at 10,000 × g for 15 min, and the supernatant was then cultured on TSA plates with 5% sheep blood at 37 • C. Viral DNA/RNA was extracted from the supernatant using a Takara Virus DNA/RNA Kit (Takara, Dalian, China) in accordance with the manufacturer's instructions. The sample infection status was assessed by screening for Tembusu virus (TMUV), goose parvovirus (GPV), goose haemorrhagic polyomavirus (GHPV), avian influenza virus (AIV), goose reovirus (GRV) and GAstV with a one-step RT-PCR kit (Vazyme, Nanjing, China) and specific primers (Li et al, 2017;Niu et al, 2017;Su et al, 2011;Yao et al, 2019;Zhang et al, 2018) (Supplementary Table S2).…”

Characterization and genomic analysis of emerging astroviruses causing fatal gout in goslings

“…AvAstV-F1 GAYTGGACNMGNTAYGAYGGNACNATNCC ORF1b gene of AvAstV (434 bp) (Todd et al, 2009) AvAstV-R1 YTTNACCCACATNCCRAA AvAstV-F2 TGGTGGTGYTTYCTCAARA ORF1b gene of AvAstV (601 bp) (Yang et al, 2018) AvAstV-R2 GYCKGTCATCMCCRTARCA GPV-F AGACTTATCAACAACCATCA(T/C) T VP1 gene of GPV (779 bp) (Li et al, 2017) GPV-F TCACTTATTCCTGCTGTAG REOV-F GGTGCGACTGCTGTATTTGGTAAC S1 gene of REOV (513 bp) (Niu et al, 2017) REOV-R AATGGAACGATAGCGTGTGGG GHPV-F GAGGTTGTTGGAGTGACCACAATG VP1 gene of GHPV (144 bp) (Gerin et al, 2000) GHPV-R ACAACCCTGCAATTCCAAGGGTTC TMUV-F GCCACGGAATTAGCGGTTGT E gene of TMUV (401 bp) (Su et al, 2011) TMUV-R TAATCCTCCATCTCAGCGGTGTAG Phylogenetic analysis was performed using the neighbour-joining method in MEGA 6.0 with a P-distance model of amino acids and complete nucleotide sequence substitution and 1,000 bootstrap replicates (Tamura et al, 2013). Genetic distances of amino acid sequences were implemented using the P-distance method in MEGA 6.0 with the pairwise deletion option and 1,000 bootstrap replicates.…”