Prenatal Morphine Exposure Increases Cardiovascular Disease Risk and Programs Neurogenic Hypertension in the Adult Offspring

Abstract

Background: The opioid overdose and opioid use disorder epidemics are concomitant with increased metabolic and CVD risk. Although opioid use disorder causes adverse pregnancy outcomes, the offspring’s cardiovascular health is understudied. We hypothesized that offspring exposed to morphine in utero would show increased CVD risk factors and endogenous opioid system dysregulation. Methods: Sprague Dawley dams were treated with saline (vehicle, n=10) or escalating doses of morphine (5–20 mg/kg per day, SC, n=10) during gestation. Cardiovascular and metabolic parameters were assessed in adult offspring. Results: Litter size and pups’ birth weight were not different in response to morphine exposure. Female and male morphine-exposed offspring showed reduced body length at birth ( P <0.05) and body weight from weeks 1 to 3 of life ( P <0.05), followed by a catch-up growth effect. By week 16, female and male morphine-exposed rats showed reduced tibia length ( P <0.05) and fat mass. In utero morphine exposure increases the mean arterial pressure and the depressor response to mecamylamine (5 mg/kg per day, IP) increases were abolished by a chronic treatment with an alpha-adrenergic receptor blocker (prazosin; 1 mg/kg per day, IP). Although circulating levels of angiotensin peptides were similar between groups, in utero morphine exposure exacerbated maximal ex vivo Ang (angiotensin) II–induced vasoconstriction ( P <0.05) and induced endothelial dysfunction in a sex-specific manner ( P <0.05). Proenkephalin, an endogenous opioid peptide that lowers blood pressure and sympathetic-mediated vasoconstriction, showed reduced mRNA expression in the heart, aorta, and kidneys from morphine versus vehicle group ( P <0.05). Conclusions: Among the effects of in utero morphine exposure, neurogenic hypertension, vascular dysfunction, and metabolic dysfunction could be associated with the dysregulation of the endogenous opioid system.

Fetal and Infant Effects of Maternal Opioid Use during Pregnancy: A Literature Review including Clinical, Toxicological, Pharmacogenomic, and Epigenetic Aspects for Forensic Evaluation

“…MTD exposure can elevate the cardiovascular risk of cardiac septal defects and congenital long QT syndrome or other arrhythmias [ 43 , 53 ]. Additionally, rat experiments have shown that prenatal morphine exposure increases the risk of hypertension in adult life, with the increase in mean arterial pressure correlating with higher levels of in vivo angiotensin II, inducing vasoconstriction [ 101 ].…”

“…The rate of clearance for clonidine is lower in newborns than in adults, peaking at 50% within two months and 90% at one year postnatal age [ 101 ]. The maturation of CYP2D6 may be involved, as the enzyme’s activity in the first week of life decreases, particularly in premature infants [ 110 ].…”

Obese Male Mice Exposed to Early Life Stress Display Sympathetic Activation and Hypertension Independent of Circulating Angiotensin II

“…mRNA was extracted from frozen eWAT and kidney cortex using the Aurum Total RNA Mini Kit (Bio‐Rad Laboratories, Hercules, CA) and iScript Reverse Transcriptase (Bio‐Rad Laboratories) to generate cDNA as previously reported. 27 The quantitative reverse transcription polymerase chain reaction protocol used was: (1) 50 °C 10 minutes; (2) 95 °C 5 minutes; (3) 95 °C 10 seconds; (4) 60 °C 30 seconds; (5) repeat steps 3 to 5 for 45 cycles; (6) 95°C 10 seconds; (7) melt curve 65 °C to 95 °C, increment 0.5 °C for 5 seconds. Primers were designed and validated to determine expression of 18s=F: 5′‐AGTCGGCATCGTTTATGGTC‐3′, R: 5′‐CGAAGCATTTGCCAAGAAT‐3′; ACE=F:5′‐GGAGTACTTCCAACCGGT‐3′, R: 5′‐GCCTTGGCTTCATCAGTC‐3′; ACE2=F: 5′‐TCCAGACTCCGATCATCAAGC‐3′, R: 5′‐GCTCATGGTGTTCAGAATTGTGT‐3′; renin=F: 5′‐CTCTCTGGGCACTCTTGTTGC‐3′, R: 5′‐GGGAGGTAAGATTGGTCAAGGA‐3′; AGT=F: 5′‐GTACAGACAGCACCCTACTT‐3′, 5′‐CACGTCACGGAGAAGTTGTT‐3′; and AT1Rs (angiotensin type 1 receptors)=F: 5′‐CGAAGCGATCTTACATAGGTG‐3′.…”