Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring

Liu, Hanxiao; Hou, Lifang; Chen, Ting; Qu, Wen; Li, Sha; Yan, Hui-yi; Wen, Xiaoru

doi:10.1016/j.reprotox.2017.10.006

Cited by 8 publications

(2 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This finding is in line with a previous report by Foudi et al who demonstrated that inflammatory cytokines could reduce PGI 2 through modulating protein kinase A (PKA)/cyclic adenosine monophosphate (cAMP) pathways, and the imbalances of TXA 2 /PGI 2 were linked with enhanced platelet aggregation, leading to vascular dysfunction in case of hypoxia ( Foudi et al, 2017 ). Pulmonary artery smooth muscle could specifically express contraction protein α-SMA under the normal physiological condition, which played an important role in the regulation of pulmonary artery pressure ( Liu et al, 2017 ; Li et al, 2019 ). Hence, we measured the expression of α-SMA in lung tissues in this model.…”

Section: Discussionmentioning

confidence: 99%

Association Between Inflammatory Mediators and Pulmonary Blood Flow in a Rabbit Model of Acute Pulmonary Embolism Combined With Shock

Wang

Liu

et al. 2020

Front. Physiol.

View full text Add to dashboard Cite

Background The pro-inflammatory cytokines were detected in pulmonary embolism (PE) and non-pulmonary embolism (non-PE) tissues to explore the role of inflammation responses and their relationship with the pulmonary blood flow in a rabbit model of acute pulmonary embolism combined with shock. Methods and Results Nineteen rabbits were randomly divided into sham operation group (S group, n = 8) and massive PE (MPE group, n = 11). The MPE model was established by injecting the autologous blood clots into the main pulmonary artery of rabbit. Pulmonary angiography showed that the pulmonary circulation time was significantly prolonged in the MPE group, and pulmonary blood flow was attenuated at 120 min post PE. Hematoxylin–eosin (HE) staining revealed enhanced inflammatory cell infiltration around the pulmonary vessels in PE and non-PE tissues, and obvious edema on the perivascular region. Meanwhile, the expressions of inducible nitric oxide synthase (iNOS) and arginase 1 (Arg-1) in pulmonary vascular and alveolar tissues were significantly upregulated and the iNOS/Arg-1 ratio was significantly higher in the MPE group than in the S group. Moreover, the levels of tumor necrosis factor-alpha (TNF-α) and interleukin-1 beta (IL-1β) were also significantly increased in PE and non-PE tissues, and interleukin-6 (IL-6) level was significantly increased in non-PE tissues in the MPE group as compared to the S group. Thromboxane A2 (TXA 2 ) and alpha smooth muscle actin (α-SMA) levels were significantly higher in both PE and non-PE tissues in the MPE group than in the S group. Conclusion Activation of inflammation mediators in PE and non-PE tissues might be one of the crucial factors responsible for pulmonary vasculature constriction and pulmonary blood flow attenuation in this MPE model.

show abstract

Section: Discussionmentioning

confidence: 99%

Association Between Inflammatory Mediators and Pulmonary Blood Flow in a Rabbit Model of Acute Pulmonary Embolism Combined With Shock

Wang

Liu

et al. 2020

Front. Physiol.

View full text Add to dashboard Cite

show abstract

“…qPCR Thymocyte cDNA preparation and qPCR analysis were performed as described. 20 T-bet, GATA3, RORγt, and Foxp3 expression levels were calculated with the ΔΔCt method and normalized based on GAPDH mRNA levels. The primers of α7 nAChR (Forward: CACATTCCACACCAACGTCTT; Reverse: AAAAGGGAACCAGCGTACATC), T-bet (Forward: GCCAGGGAACCGCTTATATG; Reverse: GGACGATCATCTGGGTCACAT), GATA3 (Forward: CGACCCCTTCTACTTGCGTT; Reverse: TG-GAATGCAGACACCACCTC), RORγt (Forward: CGACCCCTTCTACTTGCGTT; Reverse: TGGAAT-GCAGACACCACCTC) Foxp3 (Forward: AGTATGTGGTGGAGTTTGC; Reverse: TAGGACGACTTC-CATTGCT), and GAPDH (Forward: AACTTTGGCATTGTGGAAGG; Reverse: GGATGCAGGGAT-GATGTTCT) were designed using Primer Premier 5.0 (PREMIER Biosoft) and queried for homology comparison within the NCBI BLAST database.…”

Section: Western Blottingmentioning

confidence: 99%

Asthma susceptibility in prenatal nicotine-exposed mice attributed to β-catenin increase during CD4+ T cell development.

Wen,

Liu,

Chen

et al. 2024

Preprint

View full text Add to dashboard Cite

Background. Asthma, the most frequent allergic airway disease, is related to maternal exposure to cigarette smoke. Our previous studies demonstrated that prenatal exposure to nicotine (PNE), the major active product of smoking, impairs fetal thymopoiesis and CD4+ T cell development after birth. This study aimed to investigate whether PNE contributes to asthma susceptibility through CD4+ T cell development alterations. Methods. A PNE model was established by administering 3 mg/kg/day nicotine to maternal mice, and then an ovalbumin-induced asthma model was established in the offspring. β-Catenin and downstream pathways were further inhibited in vitro to confirm the molecular mechanisms underlying the phenotype observed during the in vivo phase. Results. PNE induced Th2 and Th17 biases at developmental checkpoints and aggravated asthma symptoms in the offspring. In fetuses, PNE up-regulated α7 nAChR, activated PI3K-AKT, promoted β-catenin level increase, and established potential Th2- and Th17-biased gene expression patterns during thymopoiesis, which persisted after birth. Similar results were also observed in 1 μM nicotine-treated thymocytes in vitro. Moreover, inhibiting PI3K-AKT by LY294002 abrogated nicotine-mediated β-catenin level increase and thymopoiesis abnormalities, and an α7 nAChR antagonist (α-btx) also reversed nicotine-induced PI3K-AKT activation. Conclusion. Our findings provide strong evidence that PNE is a risk factor for T cell deviation and postnatal asthma, and revealed that nicotine-induced β-catenin level increase induces thymopoiesis abnormalities.

show abstract

Inhibition of thymocyte autophagy-associated CD4+T thymopoiesis is involved in asthma susceptibility in mice exposed to caffeine prenatally

Liu

Yan

et al. 2019

Arch Toxicol

View full text Add to dashboard Cite

Prenatal caffeine ingestion increases susceptibility to pulmonary inflammation in adult female rat offspring

Cited by 8 publications

References 56 publications

Association Between Inflammatory Mediators and Pulmonary Blood Flow in a Rabbit Model of Acute Pulmonary Embolism Combined With Shock

Association Between Inflammatory Mediators and Pulmonary Blood Flow in a Rabbit Model of Acute Pulmonary Embolism Combined With Shock

Asthma susceptibility in prenatal nicotine-exposed mice attributed to β-catenin increase during CD4+ T cell development.

Inhibition of thymocyte autophagy-associated CD4+T thymopoiesis is involved in asthma susceptibility in mice exposed to caffeine prenatally

Contact Info

Product

Resources

About