Preloading budding yeast with all-in-one CRISPR/Cas9 vectors for easy and high-efficient genome editing

Abstract

The CRISPR/Cas9 technology has greatly improved genome editing in Saccharomyces cerevisiae over recent years. However, several current CRISPR/Cas9 systems suffer from work-intensive cloning procedures and/or the requirement of co-transforming target cells with multiple system components simultaneously which can reduce the effectivity of such applications. Here, we present a new set of all-in-one CRISPR/Cas9 vectors that combine unique benefits of different already existent systems in order to further expand the technology’s design possibilities. Our vectors mediate constitutive gRNA expression whereas Cas9 expression is either driven from a constitutive or an inducible promoter. The introduction of desired gRNA targeting sequences into our inducible single gRNA vector relies just on in vivo homologous recombination-mediated assembly of overlapping single-stranded oligonucleotides, thus reducing efforts of plasmid cloning to an absolute minimum. By employing the inducible system, yeast cells can be easily preloaded with plasmids encoding for a functional CRISPR/Cas9 system, thereby chronologically separating the cloning procedure from the genome editing step. Gene knockouts could be achieved with high efficiency and effectivity by simply transforming preloaded cells with a selectable disruption cassette without the need of co-introducing any CRISPR/Cas9 system component. We also show the feasibility of efficient gene knockouts even when multiple gene copies were present such as in non-haploid strain backgrounds as well as the simultaneous deletion of two different genes in a haploid genetic background by using a multiplex variant of our inducible vector. The versatile applicability of our inducible vector system was further demonstrated by CRISPR/Cas9-mediated mating type switching of yeast.

The MyLO CRISPR-Cas9 toolkit: a markerless yeast localization and overexpression CRISPR-Cas9 toolkit

“…There is substantial variation in how the core requirements for Cas9-based transformations, introducing Cas9 with variable gRNAs and donor DNA, are achieved. Some approaches combine all elements on single plasmids ( Bao et al 2015 ; Vyas et al 2018 ) whereas others rely on preloading a strain with either the Cas9 alone ( DiCarlo et al 2013 ; Jessop‐Fabre et al 2016 ) or, with the use of an inducible Cas9 cassette, together with a gRNA ( Degreif et al 2018 ). While both approaches work well, they are either cloning intensive or require longer transformation protocols.…”

The MyLo CRISPR-Cas9 Toolkit: A Markerless Yeast Localization and Overexpression CRISPR-Cas9 Toolkit

“…There is substantial variation in how the core requirements for Cas9-based transformations, namely the introduction of a constant Cas9 expression cassette with variable, yet matched, gRNAs and donor DNAs, is achieved. Some combine all elements on single plasmids (Bao et aL, 2015; Vyas et aL, 2018) whereas others rely on pre-loading a strain with either the Cas9 alone (DiCarlo et aL, 2013; Fabre et aL, 2016) or, with the use of an inducible Cas9 cassette, together with a gRNA (Degreif et aL, 2018). While both approaches have been shown to work well, they either tend to require more complex cloning strategies or longer transformation protocols.…”

CRISPR/Cas9‐Based Genome Editing of the Saccharomyces cerevisiae ADE2 Gene with Restriction‐Free Cloning and a Rapid BamHI Digest Readout

“…Targeting this gene generates ade2 mutant yeast cells, which accumulate P‐ribosylamino imidazole (a red pigment), resulting in colonies with a pink phenotype that can be screened for quickly (Jones & Fink, 1982; Ugolini & Bruschi, 1996). The ADE2 gene is a commonly targeted gene in yeast CRISPR‐Cas systems (Bao et al., 2015; Degreif, Kremenovic, Geiger, & Bertl, 2018; DiCarlo et al., 2013; Sehgal et al., 2018). The specific gRNA sequence used in this experiment (ACTTTGGCATACGATGGAAG) has been previously described (Bao et al., 2015).…”