Preliminary screening of type IV secretion system in divergent geographic sources of Clostridiumï¿½difficile

Li, Na; Jia, Hao; Yang, Hui; Ji, Bing; Liu, Yongyun; Peng, Xinguo; Cheng, Ying; Zhang, Wen

doi:10.3892/etm.2017.5065

Cited by 10 publications

(11 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A NanoDrop (ThermoScientific, Wilmington, DE, USA) was used to determine the concentration of the extracted DNA. PCR was performed using primers specific for toxins A and B (TcdA2), TcdC (TNC), and the 16S ribosomal RNA gene (16S rRNA) as control (Fiedoruk et al, 2015;Fry et al, 2012;Griffiths et al, 2010;Lemee et al, 2004;Li et al, 2017;Liu et al, 2018;Murray et al, 2009). The sequences of the primers used were: TcdA2 (F-5 0 AGATTCCTATATTT ACATGACAATAT3 0 , R-5 0 GTATCAGGCATAAAGTAATATACTTT3 0 ); TNC (F-5 0 GAGCACAAAGGGTATTGCTCTACTGGC3 0 , R-5 0 CCAGACACAGC TAATCTTATTTGCACCT3 0 ); 16S rRNA (F-ACACGGTCCAAACTCCTACG, R-5 0 AGGCGAGTTTCAGCCTACAA3 0 ).…”

Section: Pcr Analysismentioning

confidence: 99%

Prevalence of Clostridium difficile infections among Kenyan children with diarrhea

Plants-Paris¹,

Bishoff²,

Oyaro

et al. 2019

International Journal of Infectious Diseases

View full text Add to dashboard Cite

Clostridium difficile infections in Africa C. difficile pathogenesis C. difficile epidemiology CDI in young children CDI in infants C. difficile co-infection A B S T R A C TBackground: Diarrhea causes significant morbidity and mortality among children worldwide. Regions most affected by diarrhea include Sub-Saharan Africa and Southeast Asia, where antibiotics are in common use and can make children more vulnerable to Clostridium difficile and pathogens that are not affected by these drugs. Indeed, C. difficile is a major diarrhea-associated pathogen and poses a significant threat to vulnerable and immunocompromised populations. Yet, little is known about the role and epidemiology of C. difficile in diarrhea-associated illness among young children. As a result, C. difficile is often neglected in regions such as Sub-Saharan Africa that are most impacted by childhood diarrhea. The purpose of this study was to establish the frequency of C. difficile in young children (<5 years) with diarrhea. Methods: Children presenting with diarrhea at a national hospital in Kenya from 2015 to 2018 were enrolled consecutively. Following informed consent by a parent or legal guardian, stool samples were obtained from the children and demographic data were collected. The stools were examined for the presence of four common pathogens known to cause diarrhea: C. difficile, rotavirus, Cryptosporidium parvum, and Giardia lamblia. C. difficile was verified by toxigenic culture and PCR. The presence of C. parvum and/or G. lamblia was determined using the ImmunoCard STAT! Crypto/Giardia Rapid assay. Rotavirus was detected by ELISA. Results: The study population comprised 157 children; 62.4% were male and 37.6% were female and their average age was 12.4 months. Of the 157 stool specimens investigated, 37.6% were positive for C. difficile, 33.8% for rotavirus, 5.1% for Cryptosporidium, and 5.1% for Giardia. PCR analysis identified at least one of the C. difficile-specific -genes (tcdA, tcdB, or tcdC). Further, 57.6% of the stools had C. difficile colonies bearing a frame-shift deletion in the tcdC gene, a mutation associated with increased toxin production. The frequency of C. difficile was 32.6% in children 12 months old and increased to 46.6% in children 12-24 months old. Conclusions: In Kenyan children presenting with diarrhea, C. difficile is more prevalent than rotavirus or Cryptosporidium, two leading causes of childhood diarrhea. These findings underscore the need to better understand the role of C. difficile in children with diarrhea, especially in areas with antibiotic overuse. Understanding C. difficile epidemiology and its relationship to co-infecting pathogens among African children with diarrhea will help in devising ways of reducing diarrhea-associated illness.

show abstract

Section: Pcr Analysismentioning

confidence: 99%

Prevalence of Clostridium difficile infections among Kenyan children with diarrhea

Plants-Paris¹,

Bishoff²,

Oyaro

et al. 2019

International Journal of Infectious Diseases

View full text Add to dashboard Cite

show abstract

“…Nine types of microbial secretion systems are known to date, among which type 4, comprising type 4A and type 4B subfamilies, is relatively well studied and is able to deliver its substrates (DNA or proteins) to eukaryotic or prokaryotic cells (19,32). Recently, subfamily T4SS-C was found in C. difficile (14,15), though neither its biological functionality nor biochemical properties of its components have been studied.…”

Section: Discussionmentioning

confidence: 99%

“…Recently, components of a type 4 secretion system (T4SS) have been found in C. difficile genomes within the sequences of conjugative transposons (CTn) 2, CTn4 and CTn5 (14)(15)(16).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

VirB4- and VirD4-like ATPases, components of a putative type 4C secretion system in Clostridioides difficile

Sorokina

Соколова

Rybolovlev

et al. 2021

Preprint

View full text Add to dashboard Cite

The type 4 secretion system (T4SS) represents a bacterial nanomachine capable of trans-cell wall transportation of proteins and DNA and which has attracted intense interest due to its roles in the pathogenesis of infectious diseases. During the current investigation we uncovered three distinct gene clusters in Clostridioides difficile strain 630 coding for proteins structurally related to components of the VirB4/D4 type 4C secretion system from Streptococcus suis strain 05ZYH33 and located within sequences of conjugative transposons (CTn). Phylogenic analysis shows that VirB4- and VirD4-like proteins of CTn4 locus, on one hand, and those of CTn2 and CTn5 loci, on the other hand, fit into separate clades, suggesting specific roles of identified secretion system variants in physiology of C. difficile. Our further study on VirB4- and VirD4-like products coded by CTn4 revealed that both proteins possess Mg2+-dependent ATPase activity, form oligomers (most probably, hexamers) in water solutions, and rely on potassium but not sodium ions for the highest catalytic rate. VirD4 binds nonspecifically to DNA and RNA. Its DNA binding activity strongly decreased with the W241A variant. Mutations in the nucleotide sequences coding for presumable Walker A and Walker B motifs decreased stability of the oligomers and significantly but not completely attenuated enzymatic activity of VirB4. In VirD4, substitutions of amino acid residues in the peptides reminiscent of Walker structural motifs resulted neither in attenuation of enzymatic activity of the protein nor influenced the oligomerization state of the ATPase.

show abstract

“…The concentration of the extracted DNA was determined using NanoDrop (ThermoScientific, Wilmington, DE, USA). PCR was performed using primers specific for toxins A and B (TcdA2), TcdC (TNC), and the 16S ribosomal RNA gene (16S rRNA) as control ( Fiedoruk et al, 2015 ; Fry et al, 2012 ; Griffiths et al, 2010 ; Lemee et al, 2004 ; Li et al, 2017 ; Liu et al, 2018 ; Murray et al, 2009 ). The sequences of the primers used are: TcdA2 F-50AGATTCCTATATTTACATGACAATAT30, R- 5´GTATCAGGCATAAAGT AATATACTTT3´; TNC F- 5´GAGCACAAAGGGTATTGCTCTACTGGC3´, R- 5´CCAGACACAGCTAATCTTATTTGCACCT3´; 16S rRNA F- 5´ACACG GTCCAAACTCCTACG3´, R-5´AGGCGAGTTTCAGCCTACAA3´.…”

Section: Methodsmentioning

confidence: 99%

High rate of Clostridium difficile among young adults presenting with diarrhea at two hospitals in Kenya

Oyaro

Plants-Paris²,

Bishoff³

et al. 2018

International Journal of Infectious Diseases

View full text Add to dashboard Cite

Background: Clostridium difficile infection (CDI) is the leading cause of antibiotic-associated diarrhea worldwide. As a result, the US Centers for Disease Control and Prevention have designated C. difficile as an urgent threat. Despite the global public health risk posed by CDI, little is known about its epidemiology on the African continent. This article describes the common occurrence of CDI from a cross-section of consecutively seen, randomly enrolled patients presenting with diarrhea at two major hospitals in Kenya. Methods: Patients presenting with diarrhea at two major hospitals in Kenya from May to July 2017 were enrolled. After signing the informed consent, stool samples, demographic data, medical history, prior antibiotic use, and HIV status were obtained from the patients. C. difficile was detected and validated by toxigenic culture and PCR. Results: The average age of the patients was 35.5 years (range 3–86 years); 59% were male and 41% were female. Out of 105 patient s tools tested, 98 (93.3%) were positive for C. difficile by culture. PCR analysis confirmed C. Difficile-specific genes, tcdA, tcdB, and tcdC, in the strains isolated from the stools. Further, 82.5% of the stools had C. difficile isolates bearing the frame-shift delection associated with hypervirulent strains. Remarkably, 91.9% of the stools that tested positive for C. difficile came from patients under 60 years old, with 64.3% being less than 40 years of age.The majorityof the patients (85%) reported over-the-counter antibiotic use in the last 30 days before the hospital visit. Conclusions: Together, the results revealed an unusually high incidence of C. difficile in the stools analyzed, especially among young adults who are thought to be less vulnerable. Comprehensive research is urgently needed to examine the epidemiology, risk factors, pathogenesis, comorbidities, clinical outcomes, antibiotic susceptibility, and genetic makeup of C. difficile strains circulating on the African continent.

show abstract

Preliminary screening of type IV secretion system in divergent geographic sources of Clostridiumï¿½difficile

Cited by 10 publications

References 20 publications

Prevalence of Clostridium difficile infections among Kenyan children with diarrhea

Prevalence of Clostridium difficile infections among Kenyan children with diarrhea

VirB4- and VirD4-like ATPases, components of a putative type 4C secretion system in Clostridioides difficile

High rate of Clostridium difficile among young adults presenting with diarrhea at two hospitals in Kenya

Contact Info

Product

Resources

About